Fury Saga              by: Darkside

 

Soul Mates         © Darkside Oct 2000

WARNING: This story contains acts of graphic violence and acts of a sexual nature. Do not read if you are at all offended by such material, delete it from your disk now and read no further. This story should not be read by anyone under the age of eighteen so if this is you please do not proceed.

After six years of planning and writing, the Fury saga is now complete. If you wondered why there’s been no new Darkside stories for 16 months it’s because it’s taken me that long to write this; so enjoy.

More thanks than I can say go to Vickie Tern who, it’s safe to say is the main reason why I continued on. Vickie was up until 3am proofing this for me, so any errors are mine for working her too hard.

Please, please please take the time to let me know what you think (good, bad and suggestions are welcome). You giving me feedback is the only payment I get for writing.

You will need to have read the rest of the saga to fully understand what is going on here.

The story is meant to be read in conjunction with streaming real audio and hyperlinks. So please go to http://www.go.to/furysaga if you want that version.

Cue intro music, find a comfy chair and settle down to read the final part of the fury saga.

http://www.angelfire.com/scifi/furysaga/soulmates.ram

This time the battlefield is no longer the body, it’s the soul.

Comments to darkside_nym@hotmail.com

 

Soul Mates             by: Darkside 

Part 8a

 

‘There is a greater darkness than the one we fight. It is the darkness of the soul that has lost its way. The war we fight is not against powers and principalities. It is against chaos and despair! Greater than the death of flesh is the death of hope, the death of dreams. Against this peril we can never surrender. The future is all around us, waiting in moments of transition to be born in moments of revelation. No one knows the shape of that future or where it will take us. We know only that it is always born in pain."

                                                                                                    J Michael Straczynski

Prologue.

The showers that had been threatening that morning had now developed into a full scale thunderstorm, a fact that did not deter the two women and a man standing near an open graveside. The smaller of the two women clasped hold of the man’s hand and put her head on his shoulder. The other woman towered above them both, her blonde hair tied back into a ponytail and she was holding a large golfing style umbrella, which was doing it’s best to keep the cortege dry.

From across the other side of the graveyard a man dressed in a brown raincoat looked on at the proceedings thru his miniature binoculars. The man brushed away a tear as he saw the other man slowly stoop down and place a single red rose into the open grave. The two women repeated the gesture and then drew each other into a comforting embrace.

A cell phone inside the man’s coat pocket interrupted his thoughts and he quickly reached inside to answer it, "Hello?"

"Friday, this is Heinlein are you ready to proceed?"

"Can I just have a few more minutes?" the man asked.

"You’re needed to pick up the merchandise now."

"Ok will do, Heinlein?"

"Yes Friday?"

"You’re a bastard!" the man said bitterly and disconnected the call. Placing the cell phone back in his pocket the man gave another sigh. ‘Only fifteen more years to go’, he thought. But then, what’s fifteen years when you have at least another century.

o—o—o—

 

Fifteen Years Later.

A young girl sat sobbing in her room. Her long auburn hair was in disarray and swept in front of her face. Still crying, the girl rubbed her eyes and flopped back onto the bed.

A few minutes later there was a knock at the door. "Elizabeth, can I come in?" a female voice asked.

"If you have to mom," Elizabeth replied with an edge of sarcasm.

The door opened and in walked a woman of about forty. She had pale olive brown skin, deep brown eyes and her silky long black hair was tied back into an elegant ponytail. She was greeted by a cold, hard stare from the girl’s blue/gray eyes. The ferocity of the stare sent shivers down the woman’s spine, it was a stare that brought back so many horrific memories. Composing herself, she sat down by the bed and put a motherly hand on the girl’s leg. The women then started to talk. Her voice was full of concern and tenderness, "Elizabeth, we thought you had the right to know. We were waiting for the chance to tell you. We’re just sorry you just had to find out like this."

"When were you going to tell me? When I was about to get married? When I was fifty? I mean being an identical copy of one of the most feared women of the last century isn’t something you happen to drop into a mother-daughter chat, is it!" Elizabeth gave her mother another soul piercing stare.

"Actually we had decided that eighteen was the best age, sooner, if you were up to knowing. I guess fifteen isn’t a age bad to find out either. The point is, is we love you no matter who you are. It doesn’t matter to me, your dad, Auntie Cathline and to anyone who knows you or us. The only people who would care are those who might like to make a sensational story and some dirty money out of it. The rest of the world has no idea who you are and they never will, I promise."

"If I can suss it out someone else can, and then where would that leave me? I’d be imprisoned right away, for the good of society. Now I know why you make me take my medicine every day. I always thought it was to stop my asthma. I don’t even have asthma so it turns out. It’s not asthma medicine is it? It’s Olanzapine. That’s not an asthma medicine! It’s for controlling schizophrenia. That’s how I found out. I saw the prescription!" Elizabeth cried.

Elizabeth heard a set of footsteps walking towards the door.

That’ll be Dad she thought, "Come in Dad."

A tall man with blonde hair, streaked with gray strode in. "Hello little mite’ he said softly.

"Don’t you little mite me! I know what you and mom kept from me! I thought you loved me. I thought you cared for me! I hate you and if you think I’m taking any more medicine ever..." Elizabeth brushed her mom’s hand away from her leg and rose, ready to storm out of the room.

Her dad’s hand reached out, grabbed her arm and gently sat her back down on the bed again. He then sat down beside her and started to speak, "When we found out your mom was pregnant and the circumstances in which you came to be we had a choice."

"But she’s not my real mom is she! The ‘hell bitch’ is isn’t she?"

Elizabeth spat the words at her father.

"She’s your biological mother, true. But she died a long time ago. She didn’t nurse you, bring you into the world, read you stories in the middle of the night when you got scared. Dr Bexley is maybe who you are genetically, but you’re not her. I knew her even before your mother did and you are nothing like her. Please to God don’t ever think you are capable of what she did, because you’re not and never will be!"

"Is that why you lied to me about my asthma medicine?

Quickly changing the subject Elizabeth’s mother continued, "As I was saying we had a decision to make. I either carried you to term or had an abortion. Even though you weren’t biologically mine I loved you as though you were and I still do. You knew where you came from, we told you that years ago"

Elizabeth’s tone softened, "I can’t call you mom can I? You told me I was a clone of dad, not a clone of HER. Is that why you had John, so that you could have a child of your own? You couldn’t have known this from the start. Dr Bexley would never have told you. When did you find out?"

"I am your mom. And as for John that’s just plain stupid. We love both of you just the same. We found out about ten years ago. As you know you get record scores on your SAT’s, have a reading age ten years above your actual one, and have an IQ of above 160. Dr Bexley told us that you were Dad’s clone and we believed her. However since Dr Bexley’s transformation drug left the brain intact and only altered the body then there was no way you could have gotten those scores if she was telling the truth. We took you in for tests and found out that our suspicions were correct."

Elizabeth’s eyes welled up with tears once more, "That I’m the clone of one of the most terrifying women of the 20^th century. Kat, why didn’t you tell me earlier? Am I an exact clone? I read that Dr Bexley had a genetic flaw in her brain that under certain circumstances caused extreme psychopathic and homicidal tendencies. Do I have that? Is that why you gave me Olanzapine?"

Kat nodded, "I’m still your mom, we love you very deeply and just as much as we love John. Yes you do have the same flaw and yes that’s why we give you Olanzapine, just in case."

o—o—o—

Five Years Later.

He was in the middle of a conversation when he saw her, such was the effect of her on him that he immediately forgot what he was talking about and watched her walk into the biological sciences faculty. The cut of her skirt-pants was perfect and allowed him to appreciate her slender and toned body as she passed by.

"Hey Mark, did you know your PDA’s crashed?"

"Sorry?" Mark said, his mind still on this mysterious woman he’d just seen.

"You were way out there guy. I mean totally Jacko’d out," Wills said.

Mark smiled a knowing smile back at Wills. They’d been friends since kindergarten. By now they each knew the others every whim, and foible, "I’ve never seen you look at a woman like that. Sure looks as though you’ve got it bad," Wills continued.

"Got what bad?" Mark answered defensively.

Wills gave a grin and shrugged, "Never mind. You better reboot your PDA, otherwise you’ll lose the essay we were working on."

Mark flipped the small, oval shaped plastic object over and quickly depressed the CTRL-ALT and DELETE buttons on the side. He remembered his Dad telling him about the ‘old days’ of QWERTY keyboards, mice and such like paraphernalia. Standards died hard though and now the only remains of the ‘old days were these three discrete red buttons. A few seconds later and the Sony-Micro-Sun-Paq logo appeared on the screen and the PDA was ready for work again.

"Better check that essay," Wills stated.

"Who was that?" Mark asked, still distracted by the memory of the girl.

"Mark?" Wills queried.

"Sorry," Mark said and spoke to his PDA

"PDA, verify contents of memory"

After a few seconds A dulcet female voice replied, "Everything’s intact Mark. Do you want to backup your data?"

"PDA, Sure, how long till my next lecture?"

The PDA’s voice replied, "Mark, your next lecture is in 10 minutes. From your current location it will take you 15 minutes to get there. Do you want to mail the lecturer stating a reason for your lateness?"

"Shit!" Marked exclaimed and then added, "PDA Don’t bother, I’ll make it."

"See ya after hours?" Wills asked.

"Same place same time," Mark had time to call as he began to sprint to his next lecture.

o—o—o—

The woman who had been Mark’s focus of attention sat down at large, fake mahogany desk. Hunting around in her purse, she pulled out a sleeker, more expensive looking version of Mark’s PDA and switched it on.

A female voice, a smooth as a nightingale’s song spoke out from the PDA, "Good afternoon Anne, What can I do for you?"

"PDA, download the contents of the United Nations Marine Biology reports on the Coral reefs around the Maldives for the years 1995 until current day. Also give me status reports on the revised Human Genome projects, post Fury Directive til current day."

Anne paused, waiting for the PDA to catch up. Although equipped with a terabyte molecular storage datacard it still took a few seconds to store information. A few seconds later the PDA replied, "Done."

"Ok. PDA, show me the status of my bank account, screen only, apply private code 249 modulus 69. Password is, " Anne paused for a few moments before typing the word ‘Phoenix’ into the PDA’s virtual keyboard.

The PDA flashed a large seven figure sum on screen. Anne nodded in approval and then added, "PDA, show bank account status private code 148 modulus 63. Password is," Anne typed in the word ‘daughter’

"Anne, your current bank account is one hundred and three dollars and twenty four cents," The PDA replied.

"Thank’s. PDA display contents of the reports you just downloaded."

Anne sat back on her chair and started to read.

o—o—o—

Mark’s tutorial dragged on forever; his mind was still on the girl he’d just seen walk into the faculty building. Even though his grades were borderline at best and this close to the end of his Ph.D. he needed spectacular grades in order to even scrape a pass. However, at this point in time none of this bothered him. The girl going into the faculty building was all that mattered. Mark day dreamed about the girl, how her hair fell in perfect formation onto her shoulders, how her shape was contoured by her skirt-pants. In his mind the girl performed a delicate pirouette, showing every inch of her perfect form. He could imagine running his fingers thru her blonde hair, the smell of her perfume and most pleasing of all the sound of her voice. It was like music from the gods. If Helen of Troy could speak it would be like this. His mind moved deeper into his fantasy. She would, he decided be like an iron fist in an ever so soft velvet glove. She would be feminine, with all the little girl vulnerabilities but have a steel backbone. She would be like the willow delicate, supple but unbreakable in the strongest wind. She would be his shelter in the storm and he, like the oak would be hers.

Still in his dream world Mark tried out various conversations with her, examining each permutation in meticulous detail. They ranged from a simple ‘hi’ in a corridor to flowers to her dorm, with him dressed as a delivery clown. The way to her heart, he decided was to make her laugh, because her laugh would ensnare his heart and never let go.

The sound of chairs being moved backwards woke him from his daydream, the tutorial was over already and he hadn’t listened to a word! Hopefully his PDA had got enough storage space to record it and he could get the gist of it. Quickly packing up his stuff and after making a quick excuse to Wills he sprinted off to the library. She should still be there, she had to!

Breathless he bolted into the library, much to the disdain of the librarian and looked around. She was nowhere to be seen. He tried to look interested in the rows of books as if searching for a vital fragment of information but in reality he was scanning the mostly empty tables for a glimpse of her. A few minutes later, his hopes shattered and his heart in pieces he walked out of the library. She was gone!

Mark tried his best to hide his disappointment at not seeing the girl again. His pride wouldn’t let him play the lovesick teenager and go to the girls dorm and ask about her but try as he might he couldn’t get the girl out of his mind. He thought about going back into the library to ask around but he’d promised Wills he’d go and check out the latest Kweepa and Rooney movie and besides, he was due to go on a field trip to Egypt for a couple of weeks tomorrow. Still, he thought there was plenty of semester left to find her and it’d wait until he got back.

o—o—o—

"Here take a flyer miss," a well groomed young man pointed his PDA at the object of Mark’s daydreams. There was a small beep and the man moved onto his next target.

The woman wished that somebody would invent an advertising bypass function in a PDA but even her top of the range model wasn’t immune to online adverts and generally annoying commercials. Reluctantly she looked down at the flyer that had been placed in her PDA. The sight of it made her sick, she hated cults. Especially this one, this one gave her the creeps and chilled her to the bone.

The flyer said "

She was the most misunderstood woman of the 20^th century.

Her self sacrifice and compassion is a lesson to us all.

She gave up her one true love to show us how to love.

Her life was a lesson on how to forgive and obtain forgiveness.

Do you want to learn to love? Do you want to learn to forgive? Do you need forgiveness and inner peace?

If the answer is yes please call ‘The Children of Bexley’

One person CAN make a difference.

http://www.come.to/children-of-bexley"

If she could have she would have torn the flyer up and thrown it to the four winds but instead she deleted from her PDA, gave a deep sad sigh and walked back to her dorm.

Sinking down onto her bed she thought back to the flyer. Seeing it upset her more than she let on. Why did these people insist on latching onto a woman who had been dead nearly thirty years? Why couldn’t they find another 20^th century woman to latch onto, Mother Theresa, Princess Diana, Anne Frank, just anyone but Dr Elizabeth Bexley. Part of her wanted to attend one of their meetings, to prove them wrong, to correct the error of their ways, but deep down she knew it would be a futile gesture. Anyway she had larger things to attend to, like her upcoming move to England. Things were nearly ready and the timetable had just been finalized. She would spend the first two years of her doctorate in England and finish her final year back in the USA. With no family ties, such a move was a no-brainer. Wearily she picked up her PDA and started to read. ‘The last thirty years has seen a dramatic reduction in the coral surrounding the Maldives. It was determined back in the 1970’s that coral is the indicator to the ecological health of the Ocean. Such a decline can only mean that the environmental death of the Indian Ocean is less than sixty years away. This paper will outline the rationale behind this statement’.

Unable to concentrate further she put the PDA down on the bed, closed her eyes and dreamt of happier days to come. The trip to England was two days away and she still had a lot to do.

o—o—o—

"And this will be your room, Miss Stephens," A small matronly woman opened a large wooden door and gestured inside.

Elizabeth walked into the room called ,"lights," and was a little surprised that the lights didn’t slowly come on.

"Oh didn’t I mention, we don’t have voice activated appliances here. Here just use the switch," the women gestured to a small switch on the wall and as if to demonstrate her point flicked it on.

"Switch? How quaint," Elizabeth said under her breath. The room was how she expected a dorm at Cambridge to be. All old world, dark wood and musty. Bookcases lined the wall, an old fireplace with a sooty white marble hearth was against one wall. The doors leading into the other rooms had a used look about them and the green carpet had seen better days. The only clue that this was now the 21^st century was a Sony-Nintendo picture screen on the far wall, apart from that the date could have been anytime from the last two hundred years.

"If you follow me I’ll show you to your room," the woman said, pointing to one of the doors.

"This has got two bedrooms?" Elizabeth queried.

"Didn’t your mother mention, you’re going to have a roommate."

Elizabeth frowned, the last thing she needed was some prissy English girl getting in the way. Still at least she was here, on her own and about to embark on her greatest challenge to date. Elizabeth said none of this, only "No she didn’t but I’m sure it’ll be fine. Do you know her name?"

The woman gave a shrug, "No, All I know is that she’s from London."

"Which London, old or new?" Elizabeth queried.

"New I think. It’s all the same place to me dear."

Elizabeth was already getting bored with inane British conversation and decided to make her excuses. "If you don’t mind I’ve had a long trip and could really do with a shower and some time to unpack. Do I need to sign in or anything?"

"No that’s fine. I hope you’ve brought some warm clothes with you, it talks about being chilly tonight," the woman said, not really getting the message.

"I’ll be fine," Elizabeth replied.

"I hope so. This is nothing like living on that Island of yours is it? Mind you, I do feel jealous of you, y’know. With your parents being so famous n all. I wanted to be famous, did I ever tell you..."

Elizabeth desperately wanted to stop the conversation and imagined reaching down the woman’s throat and ripping her tongue out. Instead, she smiled sweetly and replied, "I’m sorry I really am very tired. I’m sure we’ll get chance to talk some more."

"Oh that would be nice, I always cook scones on Friday and you’re welcome to join me."

Elizabeth nodded and wondered what ripping out someone’s tongue would feel like , "That’d be nice. Goodbye."

"Cheerio, nice to meet you, " the woman said, and closed the door behind her.

Taking a deep breath Elizabeth walked into her room and in spite of herself flopped down onto the bed and fell asleep.

Elizabeth was awakened an indeterminate time later by someone hammering on the door. Groggily she stretched out, swung her legs off the bed and walked towards the door. It wasn’t until she had got closer she heard a male voice call out "Hey Kiddo, I know you’re in there. What’s up sleepy head, the English weather got you down already?" The voice was followed by another staccato series of loud bangs.

Elizabeth groaned inwardly, but decided to leave the comment for when she opened the door. She wondered what kind of face would best suit the moment and decided nonchalant disdain would send the right kind of message. With all necessary measures in place she opened the door.

Standing in front of her was a tall, olive skinned man with deep brown eyes, raven black hair, and a confident looking grin on his face. He was wearing the latest Beckham-Kline shirt with its wide collar and triple breasted pockets and she noted the now traditional Neo-UV sunglasses poking out of one of the pockets.

"Hi Kiddo. Pleased to see me?" the man’s rich, deep voice asked. After the question the man’s eyes gave a mischievous twinkle and he broke out into a broad disarming smile. The bright white teeth showing in start contrast to the dark olive skin.

Elizabeth couldn’t help but smile. He ALWAYS did that to her. She’d get all wound up, ready to unleash some devastating put down; but when she tried to launch it, it just died somehow. All she could manage to say was "Oh Hi it’s you. You on your own?"

The man gave another knowing smile. "Who else calls you kiddo? Mom’s here as well, she just parking the car."

Elizabeth tried her best to emulate the disarming smile, but she knew she couldn’t really pull it off. "And you can cut the kiddo crap out as well. You’re only four months older than me anyhow. You’d better come in. I’ve not had chance to unpack yet so I can’t offer you much in the way of a drink."

"So’k we were well fed on the starplane."

"You got to go on one of those? I thought there wasn’t a regular service yet?" Elizabeth stated. The boredom and stress of a nine hour flight from New York hadn’t yet subsided.

"Mom pulled a few strings. It was out of this world. You take off from JFK like a normal jet, climb to 50,000 feet and then WHAM the ramjet kicks in until you’re nearly in low orbit. You get another WHAM when the rocket part of the engine kicks in and presto New York to London in under an hour. They say it’ll do NY to Sydney in under two. A-F-ing-mazing. Brits invented the thing too, years ago just nobody wanted to put money into it."

"You make me sick. You always manage to go one better don’t you." Elizabeth said jokingly.

"Hey that’s what I’m here for."

"AND it helps that your mom is Rachel Martin doesn’t it?"

"That too. Hey I’m really tired after my 50 minute flight. Can I sit down?" the man asked, and gave a long false yawn.

"Sure, you can see where the sofa is", Elizabeth replied, not rising to the bait.

"Was someone just talking about me?" A voice called out from behind the doorway.

Elizabeth gave a squeal of delight and ran to hug the figure now standing at the door, "Auntie Cathline! Hi"

Cathline responded to the hug, "Hi Lizzy, long time no see."

"You betcha. You look great! Come in."

Cathline gave a smile, "Thanks I always look great."

This was a running family ‘in joke’. Now nearly fifty, Cathline could still pass for less than thirty. When people asked her how she did it she’d always reply with the comment "it’s in the genes". Cathline Richards alias Rachel Martin could still stun a room of people with her grace and beauty.

Still grinning from ear to ear, Elizabeth beckoned Cathline to sit down next to her son. Elizabeth sat down on the opposite armchair. "Is mom and dad coming over?" Elizabeth asked expectantly.

Cathline’s perfect face dropped a little, "They couldn’t make it this week. Senator Jameson’s asked them to help out with his presidential campaign so they’re all caught up in that. Kat, sorry. Your mom asked if I wanted to run for Congress as well but I’m not into that kinda thing."

The man sitting next to Cathline patted her leg in mock comfort, "Ahhh how sad, you’ll just have to put up with being a roving UN Ambassador won’t you."

"So that’s how you pulled off the Starplane flight?" Elizabeth stated. "That’s an abuse of privilege isn’t it?" Her quip hid over the fact that she was bitterly disappointed that her parents hadn’t turned up to see her settle in, typical! At least Cathline was here.

Cathline gave another devastating smile, "Hey not my idea. It was Alex’s. It’s not my fault he talked me into it."

Alex gave an incredulous look "No Mom it wasn’t was it?"

Elizabeth relaxed a little. Being with Cathline always had that effect on her. Her son, Alex however had the opposite effect. Somehow he knew what buttons to press to make her feel off balance and awkward. It was a knack that usually only big brothers have, but he seemed to have acquired it anyhow somewhere down the line too. Elizabeth was saddened to hear that her mom and dad couldn’t make the trip and on that thought said, "I’d have thought mom and dad could put aside just one trip to see me settle in."

Cathline gave a comforting smile, "They do love you Y’know. When they said that they couldn’t come I thought the same thing as you. Kat as always knew what I was thinking and explained that they trust you to do the right thing and that you have it all in hand. Of course they’ll visit next week just to be sure, but I wouldn’t worry about them not loving you. Kat cried herself to sleep at the thought of her little girl moving away for so long. They will miss you. Alex dear go and swipe the meter for me, I’m not sure how much time I put on it."

"OK mom," Alex said, and left the room.

"Good! Now he’s gone for a while, so I can say what I really want to say." Cathline said in a secretive way.

"Which is?" Elizabeth offered.

"I hate keeping the truth about you from Alex, but it’s the best way. As far as he knows you’re Kat’s daughter not Dr Elizabeth Bexley’s. Some things are best left unsaid. Anyway the real reason why they’re not here is that they wanted you to stand up on your own for a while. Sure they’ll be there to catch you if and when you fall, but they don’t want to repeat the mistakes Dr Bexley’s parents made of wrapping her up in cotton wool."

"I know. We decided a few years ago that if we couldn’t change the genetic factors we can change the environment. I’m glad you’re here Cathline. I need someone to talk to."

Cathline placed her hand on Elizabeth’s arm, "I know that’s why I came."

Elizabeth suddenly had a revelation but only raised a quizzical eyebrow in response, "It’s odd. I know, sorry I can feel why you’re doing what you’re doing. You’re playing the counterbalance role aren’t you. You’re the soft edge to mom and dad’s hard one aren’t you? They’ve asked you to look after me in ways that they won’t allow themselves to. You’re my safety net. My judge and jury. What happens if I start acting like HER?"

Cathline was inwardly shocked at Elizabeth’s insight. She scrabbled around for an answer and tried to think of a way of averting more questions. Elizabeth would be able to spot a lie instantly. Cathline nodded slowly and answered, "You’re your mother’s daughter alright."

Elizabeth raised her voice a little, "Which Mother? Kat or my real one?"

Cathline gave a smile, "That, kiddo, is entirely up to you."

Elizabeth was still rattled by her revelation. So much of her childhood slotted into place now. Why hadn’t she seen it earlier? "It fits It all fits. The three of you, mom, dad and you decided as soon as you knew about me how you were going to raise me and what you were going to do in the event of me turning out like the hell bitch."

Cathline could sense the anger starting to brew inside Elizabeth. She needed to defuse it and fast, "You are quite correct. But I don’t see how it’s any different from any other parenting. With Alex I had a plan how I was going to raise him before he was even born. I knew what I was going to say and do in certain situations before they came up. Any good parent knows how they want to bring up a child before they have one. Sure they can change plan or tack as things evolve. Listen, who you are has made no difference to the approach we used to bring you up. I’m your God Mother right?"

Cathline’s logic was starting to defuse Elizabeth’s anger.

Elizabeth just nodded in response.

"Well, I take that role seriously. It’s my responsibility as your God Mother to ensure that you are being brought up in the correct way. It’s the same for John as it is for you. If I’m acting as the counter balance as you call it, it’s because we think a counter balance is needed, not because your mother was Dr Bexley. That’s an important difference."

Cathline was right of course, "I hate it when you three gang up on me," Elizabeth replied.

Now in full flow Cathline continued, "It’s not us versus you. It’s not you versus anybody. It’s how Kat and Matthew decided to bring you up. I knew Elizabeth Bexley when she was a little older than you and you are nothing like her. From where I’m sitting Kat and Matthew have done a wonderful job of raising you. You’re a brilliant, witty and sensitive young woman. You’re more like Kat than HER and I should know. Listen, how many times must you be told before you believe us. You are nothing like your biological mother and never will be!"

"Then why all the subterfuge? Why make me take Olanzapine until I was old enough to decide for myself?"

That was a question Cathline refused to answer.

Elizabeth however refused to let it drop. "I thought as much. You DO think I’ll turn out like HER."

Cathline made eye contact with Elizabeth and said, "No we don’t! Out of all the time you spent with Matthew and Kat did you ever think for one second that they didn’t love you?"

Elizabeth knew that Cathline was right, "No," she shook her head gently.

Cathline continued, "That’s a thought worth holding onto don’t you think? Look this is something you need to talk to Kat or Matthew about. This goes beyond my...."

"Beyond What Mom?" Alex called out as he entered the room.

Cathline jumped ,"Alex, don’t do that to me. How long have you been lurking?"

Alex shrugged "I don’t lurk. The Meter was all paid up anyway.

When do we eat?"

Cathline turned to Alex and said, "We don’t. We’ve got to leave now. We’re taking a normal flight back, and I’ve got some business to attend to in New London. Elizabeth, remember what I said to you earlier. I’m sure you’ll settle in just fine."

"But mom, we just got here," Alex complained.

"I know you want to wind up Elizabeth some more, but I think she’s got enough to do. Elizabeth, nice to see you again. Say bye Alex."

Alex replied with a grin, "Bye Alex"

Elizabeth stood up and gave Cathline a hug, "Thanks Auntie Cathline. Tell mom and dad they were right won’t you?"

"Sure," Cathline said and returned Elizabeth’s embrace. She was relieved she’d managed to avoid a fight with her. Kat was right. Elizabeth needed to be handled the way they’d planned it. It was the only way.

o—o—o—

Angela Holden struggled with her bags as she strove to get to her new room. The cab driver had dropped her off nearly a kilometer too short and now as she clutched all her worldly goods she really wished she had some knight in shining armor to help her carry it all.

She could just see her destination when she saw a very tall, stunningly beautiful woman walk out of there, followed by a tall athletic young man. The man casually looked around him, apparently taking in the serene, scholarly and timeless atmosphere that Cambridge still generated after all these centuries. Angela’s heart skipped a beat as she saw him look at her struggling with her bags. He tapped the tall woman on the shoulder and whispered something to her. The woman turned and her single good eye looked right at Angela and she nodded her approval to the man. Angela eyes widened, Rachel Martin! Before she could think any further she saw that the young man was running towards her.

"Hi, I noticed you were having trouble with your bags? Mind if I help?" the young man asked Angela.

Angela, now fully composed, took the opportunity to study her potential rescuer. She would later describe him as tall, dark and handsome . Gallant too if his offer for help was for real. Before she could say anything he followed on, "I’m sorry my name is Alex Richards and you are..."

"Angela Holden, " Angela blurted out. This is Rachel Martin’s son!!!

"Well Angela Holden, you have two choices. You can let me carry your bags where you want to go, as long as it’s not Oxford or anything, or you can struggle with them yourself? "

"I’m sorry I wasn’t expecting..." Angela blurted out. She’d seen Alex’s face in several magazines, but to meet him face to face had taken her breath away. In her teenage years she’d had a crush on him, and now to finally meet him was too much.

Alex gave another wide smile, "It’s ok, I have this effect on women all the time. Here let me take that for you," Alex offered to take the largest two bags from Angela.

Much relieved Angela let the bags go and instantly felt better. Her shoulders felt raw from the straps digging into them and to have any kind of relief was a godsend. "My room’s 22B, " she managed to say. She noted a ‘Oh no’ kind of look flick across Alex’s face, but it was gone before she could be sure what it really meant.

Alex hoisted the large bags onto his shoulders with an ease that surprised Angela and started off towards the direction he had come from. Angela went to show Alex where her room was, but Alex seemed to already know. "It’s just on the right," Angela said.

Alex nodded and put the bags down onto the floor and knocked loudly.

"Ok, Ok," A voice called out from the room and Angela heard the sound of a key being turned in the lock. Angela then had her second shock of the day. Standing in front of her was none other than Elizabeth Stephens. Her hair was a little untidy and it looked as though she had just woken up. That face with it’s tumbling mass of auburn hair and blue-gray eyes was unmistakable.

Alex broke the silence "Before you say anything Kiddo, I’m here helping your new roomie with her bags."

Angela saw those blue-gray eyes flick a curious look in her direction as if saying ‘I’m not sure about this,’ but then the mouth broke into a wide smile, "Hi I’m.."

"Elizabeth Stephens," Angela completed in a hushed overawed tone.

"No hiding from this face is there?" Elizabeth grinned. "I’ll take your bags for you. Alex, in the best possible way, get lost!

Auntie Cathline is waiting for you"

"Okay, okay, I know when I’m not wanted," Alex tutted in such a way that Angela knew she wasn’t that upset about being given his marching orders. Alex turned to Angela and said "Angela it’s been a pleasure meeting you. I don’t envy you having her for a roommate. If you ask me they should never have let her out." With that last comment Alex gave a single fingered salute and turned to leave.

Angela turned round and gave an appreciative glance at Alex’s ass, "Very nice," she commented.

"So’k, you can have him," Elizabeth retorted. "Now let me show you around."

o—o—o—

Anne Baxter sat on the plane staring out into a bright blue sky.

The view from an aircraft never ceased to amaze and stun her. She loved to lose herself in the endless variations of cloud, land and sky. To her, flying was the second most enjoyable way to travel. By far and away she preferred diving. She had first done it years ago and had never forgotten the feeling of absolute freedom and oneness with nature. It was this feeling that had driven her to study marine zoology and biology. Her career in medicine had been cut short by the love of the ocean and it was one she never intended to follow up again.

She had enjoyed her time at Haverford, but now it was time to move on. Since the death of her parents when she was younger she had, had no real home, and no roots to put down, and that, she decided, was just the way she liked it.

Her transfer to England had fallen thru at the last moment, something to do with her visa she was told, but she had been given an alternative placement in Tel-Aviv for six months before having to return to Haverford. Looking on the bright side Tel-Aviv was a whole lot warmer than Portsmouth and the Red Sea was more inviting than either the North Atlantic or Anglo-French Channel.

Tel-Aviv had been repopulated for over ten years, the deadly agent spread by the Guild had been neutralized, the remains of the people cleared away, and much of the infrastructure rebuilt. Tel-Aviv was now one of the most modern cities in the world, the chance to improve had not been missed but still, so it was said, the aura of death hung over the city. Elizabeth had used her PDA to brush up on the new Amex-Rough guide entries on it, and the thought of living in a place where over half a million people had been slaughtered was enough to make her stomach churn. How could she walk down those streets knowing that in every house and every office block people’s lives had been snuffed out?

She shut out anymore thoughts and reflected back on what she really wanted to do. Go diving, study marine life, and finish her dissertation.

The plane was starting it’s descent and she would be in Tel-Aviv in just over twenty minutes.

o—o—o—

"Ok then, Heels or flats?" Angela grinned.

"Flats, anytime," Elizabeth replied.

"Same here. We’re about the same height and heels make me look far too tall," Angela retorted. They’d been playing the ‘answer right away’ game for a while now.

"My turn. Skirt Pants or Skirts, " Elizabeth asked, casting a quick glance to the black Skirt-Pant she was wearing.

"It’s pretty obvious what you prefer, "Angela grinned.

"It might not be. I might hate this, but it’s the only thing that was clean. Anyway you’re supposed to answer without thinking. That is the purpose of the game is it not?"

"Ok then, Call me old fashioned, skirt."

"My turn again, Beckham-Kline or Armani?," Elizabeth queried.

"Oh yes old bean, Beckham-Kline! I never buy less than five at a time," Angela joked, putting on a false English upper class accent.

Elizabeth felt embarrassed. Much to her amazement she was getting on extremely well with Angela, and had forgotten that not everyone could afford the designer outfits she wore. "I’m sorry. I didn’t think," she muttered.

"It doesn’t matter. My Mum and Dad had to save for fifteen years to send me here, and the fact that I’m—how’d you call it— roomies with the famous Elizabeth Stephens, and at the best university in the world is more than enough," Angela said, piling on Elizabeth’s guilt.

"This is a stupid game," Elizabeth commented.

"Ok my turn then. Money or power?" Angela asked.

"Power, anytime."

"Money," Angela smiled back.

"Can I ask you a favor?" Elizabeth asked.

"Depends. We’ve only known each other an hour," Angela retorted.

"Forget who I am."

"Huh?"

"You’ve mentioned me three times as though I’m some superstar. I came here to be me. Not some media image, or some fixation of that perverse Bexley cult, but to discover who I am and where I fit in. Please let me be just plain ol Elizabeth Cathline Stephens."

Angela ought to have been upset, but Elizabeth had been right, she had been looking at her as though she was some royal princess. "Ok, Lizzy. I’m sorry, it’s just that I’ve never even seen anyone remotely famous let alone live with them. My Dad used to be a computer programmer, before it all became automated and he was laid off. And Mom worked as a secretary for Sony-Micro-Sun-Paq. We never even went on holiday, sorry "vacation," as they put every Euro they had into giving me a better chance than they had."

"It must have been hard. They must really love you," Elizabeth said softly.

Angela thought she detected a note of jealousy in Elizabeth’s voice, "I just hope I live up to their expectations."

"I’m sure you will. If you put your mind to it you can do anything. It’s not been a picnic for me either. Yes Mom and Dad never had to save to get me anything but I’ve always been in the public eye. I’ve had more DNA tests than I can remember, psychological screenings, IQ tests. And those photo’s on the front of the Enquirer last year were the worst ever. I have had no privacy, and when people look at me they don’t think oh look

that’s Elizabeth Stephens they see HER, Dr Elizabeth Anne Bexley. That horrid Bexley cult is the worst of the lot. Until tests proved otherwise they thought I was the Second Coming or something. That’s the hardest thing of all. I can cope with blurry topless photo’s of me on my mom and dad’s island but any reference to the hell bitch just gets me right here, " Elizabeth pointed to her heart.

"I’m sorry. Look if it’s any help I don’t believe any of those rumors. I was just a little star struck that’s all," Angela said, now it was her turn to feel guilty.

"Hey I’m star struck too. It’s not everyday I get to share a room with Dr Angela Holden the greatest neurologist the world has ever seen," Elizabeth grinned. The tension had been broken and each of them had shown an exposed side of them. The bond of acquaintance had grown into the glimmer of trust.

o—o—o—

Wills caught up with Mark in the canteen. He’d been worried about him for a few days. Mark had been sullen, almost silent, and to make matters worse had skipped several tutorials. At this rate Mark was on collision course to fail his doctorate. Wills had tried to talk to him several times but each and every time he had gotten the cold shoulder treatment. It didn’t take the length of time they had been friends to work out that something was very wrong with the normally upbeat Mark.

"Hey bud," Wills said cheerfully.

"Huh," Mark replied in a sullen tone.

Wills gave Mark an ultimatum "Ok. Look, you can ignore me or grouch at me all you like but I’m not going away ‘til you talk to me."

"Ok fine, but there’s no point. You can’t help me, you’ll just have to put up with me," Mark replied.

"Since when have I ever put up with you?" Will asked with a comforting smile on his face,

Mark managed a shrug back "Since now."

Wills indicated to Mark that they should take a seat at an empty table at the far end of the canteen. Mark grudgingly agreed and sat down opposite Wills.

Mark, admitting defeat and feeling as though he had to tell someone, fiddled with his chicken salad for a while before giving Wills a lost puppy dog look. "I went to find her."

"Who?" Wills asked.

"The woman I saw going into the faculty the other week."

"You never told me?" Wills asked.

"As soon as I saw her I couldn’t get her out of my mind. Something just clicked inside me and I knew that she was the one."

"How can you know that? Anyway let me guess, she blew you out," Wills said. He was tempted to make some kind of quip but by the look on Mark’s face this was no joking matter.

"Worse. Her neighbor told me that she’s gone to Tel-Aviv. Now I’ll never see her again. If she’d blown me out as least I’d have known where I stood, but now I’ll never know. I was so sure she was the one. Now I can’t concentrate on anything and my grades are slipping. That makes me more depressed and makes me think more about losing her. I’m in a vicious circle," Mark now looked thoroughly down.

Wills, all thoughts of quips now quashed, said, "Did you get a name. She can’t have gone to Tel-Aviv forever, she has to come back here to finish her course."

"I thought of that but her neighbor told me she was going to England for two years but that got cancelled and so she went to Tel-Aviv instead. Two Years, that’s a long time. She’d find someone else in that time. I may as well face it, I blew it, the one woman I ever wanted and I’ve blown it."

Wills had an idea. "Look what’s her name, we can look her up on the net’s white pages. Find out all about her and then we’ll know more. As for your grades, if you’re not here in two years how can you meet her when she gets back?"

Mark gave a smile. Hope had been restored and Wills was right. He would work harder now. He had to be here when she came back. "Her neighbor gave me her name, Anne Baxter."

o—o—o—

 

Anne eventually emerged from the Tel Aviv arrivals lounge and was hit by the dry heat of the midday sun. After waiting in line for her baggage she headed for the local Avis rental desk. It was a fair drive to her lodgings and already she was tired from the long flight over. After queuing for about ten minutes she reached the desk.

"Passport please," the Avis lady asked.

Anne noted how all service desk, Hostesses and receptionists all seemed to look the same the world over. Maybe it was their impossibly sunny disposition that caused made her think that. Anyway she handed over her passport to the lady.

The lady studied it for a few moments before returning it, "Driving permits please."

"Will this work? It’s got all the options I want?" Elizabeth fished out her PDA and showed it to the lady.

"Sure, just aim it at the terminal, its called Avis4526"

Anne was relieved, the last thing she wanted to do was fill out masses of forms. She pointed the PDA at the lady’s terminal, "PDA, transmit my driving permit and hirecar details to terminal Avis4526."

The lady gave a smile, "Thank you Ms Baxter. You car is in lot 24. It’s the blue GMFord starlight. It’s been serviced last week and there’s a spare fuel cell in the trunk if you need it. I’ve transmitted your biometric profile to the car so all you need to do is grab the handle. I’ve also sent an online map of how to get to the car so just consult your PDA. Enjoy you stay, thank you for using Avis."

Anne gave a nod of thanks and wheeled her luggage cart outside into the blazing heat of the day. On her way out she noted the small plaque on the wall commemorating the twenty three thousand men, women and children that had died at this airport over twenty years ago. Anne had seen this in the guidebook. In every building and street there were memorials to the dead, but seeing it here on a wall really brought home the atrocity that had been committed in this now thriving city. She hoped she would be able to remove the morbidity of this place from her mind but then again did she want to? Would doing that deprive her of her compassion? Only time would tell.

Anne consulted her PDA and a flashing arrow told her that the Avis depot was two hundred meters to the left. A few minutes later she was standing next to a Blue Gmford. It had been newly washed and sat there gleaming in the sunlight. Anne grabbed the handle of the car and the door sprung open. Miniature sensors on the car handle had read her hand and fingerprints. Cross checked them with its database and had decided that she was who said she said she was. Anne reached inside the car and pressed the trunk release and moved around to the rear of the car and loaded her luggage into the trunk. After dutifully sliding the cart back into the cart retrieval area she got inside the car and closed the door.

Within a few seconds the cars climate control had kicked in filling the car with warm, cool air. Anne had one last thing to do before she was ready to leave, she pointed her PDA at the car entertainment system. "PDA, download all music tracks to Gmford regno A56433X. Also program GeoNav system with our destination and work out the quickest route avoiding all current congestion," the PDA confirmed its acknowledgement.

Anne felt her seat reshape it’s self to give a perfect fit, and after settling herself down. She pressed the start button on the console and felt the smooth hum of the engine. "Car engage autoNav and let me know when we’re five minutes away.

"Yes Ms Baxter," the car replied in a smooth silky female voice. Anne gave a smile, Rachel Martin would do anything for money these days. Anne felt the car move off and onto the freeway. Anne’s own car was nowhere near this advanced and anyway she preferred to drive herself. Anyway was there any other way to drive a late 2000 model year Porsche?

"Car, dim the windows and play track 4, no video, audio only."

Anne sat back into her chair, closed her eyes and started to listen. This was just the song that matched how she felt at the moment.

"I stood close enough to hear you say

‘Do as the beautiful ones do’

Tore out my picture from its frame

I just wanted to be one of you

Standing on the outside

Lookin’

Lookin’

Funny how you see the truth

But the feeling does come back

To you

She’s crazy as anyone can be

That’s what they say

They say of me

Wanting love can make one do

Isn’t my fault

Heredity

Standing on the outside

Lookin’

Lookin’

State of grace

State of sin

Standing on the outside

Lookin’

Lookin’

I cannot feel a single thing

But the feeling does come back

Again

This morning feels like yesterday

Yesterday follows me around

Where do you go where no one cares

Six feet under

Underground

Standing on the outside

Lookin’

Lookin’

State of grace

State of sin

Standing on the outside

Lookin’

Lookin’

I cannot feel a single thing

But the feeling will come back

Again - again"

o—o—o—

"So your parents worked for fifteen years to send you here?" Elizabeth asked. It was now nearly eleven pm and they had been talking for hours. Elizabeth felt relieved things were going so well. Later on in the week when she called Kat she would describe Angela as ‘normal’. But for now Elizabeth was just glad to have someone her own age who she could just be herself with. Of course it was early days but, judging by the signs it was going very well. Her only point of reference for this kind of friendship was the sisterly bond between her mom and Auntie Cathline. Although her friendship with Angela was a long way from being that close it did have a positive beginning and that Elizabeth decided was more than she’d hoped for.

"Yeah. I determined to work my hardest so that their sacrifice wasn’t wasted. I’ve borrowed a PDA, brought the cheapest e-books I could find and promised I’d pay them back every Euro they gave me."

"I’ve had to pay for myself to be here. Sure mom and dad give me an allowance but my tuition fees and everything else comes from my own money." Elizabeth stated.

"Gave you a million to play with did they?" Angela said with no hint of sarcasm or malice.

"I wish. They looked at what the average student needs and gave me that amount. They made it damn clear that if I needed anymore then I’d have to work for it."

"Whoa that’s tough!" Angela said. She was surprised. She had expected the famous Elizabeth Stephens to be on a sum fit for a princess.

"You don’t know the half of it. Sure I’ve got my Beckham-Kline outfits and Armani skirt-pants but I had these before I became a student here. My mom and dad are adamant. They had to make it by themselves so I have to. "

"That’s a tough lesson, but fair I guess. Tell me are they like they are portrayed in the past. Did the things they say happen really happen?" Angela asked.

"If you mean do I believe what they tell me or what other people have said, I believe mom and dad every time. It’s no accident who I look like. I saw photos of dad and Mom when they were transformed. I’ve seen Auntie Cathline’s ruined eye and I’ve seen more evidence of Dr Bexley’s evil than I care to think of.

Sure she redeemed herself to the world at the end but not before causing a lot of people a lot of pain"

"You sound bitter against her. She’s been dead for twenty years and I was always told she emerged a heroine. Her final act of stopping a war was seen as a triumph and her tragic suicide just added to the mythos," Angela said.

Elizabeth shrugged, "Sure that’s the way the history books tell it but what people don’t get is that it should never have happened in the first place. Even Mom and Dad have a rose tinted view of her now, they say that she strengthened their relationship beyond what it would have ever become and that probably the destruction of Tel-Aviv and Cairo would have happened at some point in time anyway."

"They are probably correct. At the time it was seen as a great horror but sooner or later somebody was going to use a genetic weapon and nuclear ones too. That’s the benefit of hindsight. We know the socio-economics of the time and can work backwards from there. A Middle East conflict was inevitable. If the Guild didn’t do it, Iraq would, if Iraq wouldn’t then somebody else would. As soon as somebody found a way to create a genetic weapon then it’s going to get used. Dr Bexley just happened to be in the wrong place at the wrong time. In some ways she was there are the right time, your parents too", Angela stated.

"That maybe and that’s what the history books teach but I still hate her for what she put Mom, Dad and Cathline thru. Mom used to call her ‘hell bitch’ and that name suits her just fine," Elizabeth was showing real emotion now. In some ways she wanted to tell Angela the truth about her relationship to Dr Bexley but that was one secret she was determined to keep.

"Remind me never to cross you," Angela said with a smile.

Elizabeth grinned back, "Hey no problem. I’m beat and we’ve got a big day tomorrow. See you in the refectory at midday?"

Angela nodded her agreement. Like Elizabeth she was pleased with the way things had started off.

o—o—o—

The first week or so of Elizabeth’s course went surprisingly quickly. Cambridge was a fascinating city with so much history that Elizabeth couldn’t help but fall in love with the place. It was so wonderfully quirky and full of tradition, most of which people hadn’t a clue where they came from but performed anyway. There were innumerable book shops, still selling paper bound copies and little markets tucked quietly away in the corner of some ancient cobbled street. She had spent a number of free periods in the museums and still admitted she hadn’t even scratched the surface. She and Angela had enjoyed a quiet picnic by "the backs" a secluded stretch of green straddled by the clear, slow moving river Cam and had booked next week to go for a punting trip down the river. At the moment her studies were lightweight but she knew as the weeks drew on the the pace would rapidly ramp up. For the moment she lapped up every second of the olde worlde atmosphere of the ancient city.

She was now spread out on the sofa, she had put away her Beckham-Klines for special occasions and had splashed out on the de-facto student attire of denim jeans and baggy sweater. Her new hairstyle still felt strange and she missed her long flowing locks, but the shorter style was more practical and attracted less attention. Angela had wanted her to go blonde but this was too radical a move for her at the moment. It did give her a rather ‘girl next door’ look but she didn’t mind. She wanted to move away from the old Elizabeth and find her own way. She was a little sad that her parents hadn’t yet had time to visit but she suspected that this was their plan all along. This suited her just fine at the moment, she was relishing her independence although she was glad that at least Angela shared her neurology class. She gave a yawn and reflected on her relationship with Angela. For two people of such disparate backgrounds they shared a lot of common views. Angela had soon lost her starstruck awe of her and that Elizabeth thought was a welcome change. Angela treated her for who she was not where she came from.

Elizabeth had had childhood friends. Alex was one of her closest in spite of all his teasing but Angela was rapidly becoming one of her ‘inner circle’. Of course she had told no one about her real origins, that would ruin everything. It shouldn’t have made much difference to her who her mother was but in the back of her mind she couldn’t help but worry if she was destined to turn out like her. What worried her most was that by all account the hell bitch’s parents hadn’t been much different from her own. If they had been powerless to stop what happened to Elizabeth then surely hers would be too. Elizabeth knew that she couldn’t help but be hurt somewhere along the line she just wondered how far that hurt would need to run.

At the age of eighteen her parents had given her the responsibility for choosing whether to take the Olanzapine or not. Initially she had chosen not to but as it dawned on her that environment or not she had the same mental flaw that caused the Hell bitch to wreak so much havoc she owed it to herself and any future partner not to take that risk. So, everyday she dutifully took her Olanzapine, it would be foolish not to. Angela had asked what it was and Elizabeth had told her it was her Asthma medicine. It was even specially stamped with the wrong label so that a casual glance couldn’t give it away.

Elizabeth’s train of thought was interrupted by a loud knock on the door. Wearily she got up and answered the door. On seeing who it was she gave a whoop of joy and embraced the couple at the door. "MOM, DAD you came!"

"Hi little mite," Matthew said with a smile. It had been too long since he’d seen his number one daughter.

"I like the hair. It makes you look a little stern but a lot more mature," Kat commented.

"How, how?" Elizabeth started. She never expected to see them this early on. She’d been told they’d visit in a month or so.

Matthew gave a smile "We took a detour on our way over to Manhattan. We thought we’d drop in and see how you were doing."

"Please come in, it’s a little bit of a mess. Where’s little bro?"

"Thanks. John’s at Yale. He couldn’t make it over but I’m sure you’ll see him at the end of the semester," Kat gave Elizabeth’s apartment the once over. The little bit of mess Elizabeth was referring to was two unwashed coffee cups on table.

"Nice place. How’s the roomie working out?" Matthew asked, taking a seat on the sofa.

"Angela? She’s great. When I first heard I was getting a roommate I was afraid that I’d get some prissy English girl but Angela’s not like that at all. She should be back soon, I’m sure you’ll like her," Elizabeth looked guiltily at the coffee cups and discretely put them into the kitchen area.

"It’s ok Liz. You are allowed to be messy sometimes. I thought it was traditional for a student," Kat said.

"That’s what Angela says. You should see her room. It’s a tip. She does clear away the meal things though which is the main thing."

"That’s my girl. Never a thing out of place," Matthew grinned.

"How’s the course going. Not too much hard work is it?" Kat asked.

"Is anything ever hard work for me? Not really, they’re still in ramp up mode at the moment so I’ll have a better idea in a month’s time. Cambridge is wonderful, so much history, and the quality of the research is nothing like we have back home," Elizabeth enthused.

Kat put on her serious mother-daughter chat face, "Cathline told me you were feeling a little abandoned when you first got here. You seemed to be building up to a fight with her when Alex walked in. Are you ok now?"

"I guess so Mom. I wish you didn’t live either side of a continent or ocean, there’s so much I want to tell and show you, but I can’t because you’re over there and usually too busy to leave," Elizabeth said sadly. As always her mom had gotten right to the heart of how she felt. Sometimes it was infuriating but other times like now it was a welcome relief. Cathline had told her she felt exactly the same way about Kat sometimes. It was one of her mother’s defining character traits.

"It works both ways Elizabeth. We need to give you enough slack and freedom to find out who you are but be there if and when you fall. It’s a delicate balance and it’s one we’ll admit we haven’t got right yet. Not with you and not with John. All we can do is hope we’ve given you enough to know what’s right and wrong and to use compassion, wisdom and courage that we know is in you. It looks to us that you’re doing just fine. We have our own lives to live just as you have yours. But the thing is, the real thing to hold onto is that we are there for you, and if we should ever need it you are there for us. That’s what family is all about," Kat said in her most reassuring voice.

Elizabeth felt relieved at this. Kat had a way of sorting things out in just the right way. "Mom I’m worried about me. I feel like a time-bomb about to go off. I’m so scared to get into any kind of deep friendship with anyone, just in case they hurt me and I go and strike back. When the hell bitch struck back, people died."

"Are you talking about this Angela?" Matthew asked.

"I guess so. She’s tried to fix me up with a date a couple of times but I’ve turned them all down. Is it right for me to feel like this?"

Kat placed a hand on Elizabeth’s leg to reassure her. "You can’t keep holding people at arms length. You’ll end up a very lonely and shallow person otherwise. What’s the point in being able to feel, talk and love if you can’t share them with anyone? You may as well be a robot, devoid of any emotions or the qualities that determine our humanity, Take Alex for example. Do you know why he treats you like a kid sister?"

"Because he hates me? Thinks I’m a pain in the ass?" Elizabeth answered.

Kat gave Elizabeth a smile, "Alex doesn’t hate you. He may think you’re a pain in the ass sometimes and he’d be right. He asked me a while back how to reach out to you. He doesn’t understand you. His teasing is his defense mechanism. He wants to be closer to you, to really get to know who the real Elizabeth Cathline Stephens is, but you’ve spent all your life pushing him away."

"He never told me any of this," Elizabeth stated. What was mom driving at?

"He wouldn’t. He cares too much about you to put pressure on you like that. He wants to be your friend, but on your terms."

"You mean he’s got the hots for me?" Elizabeth said. Surely not!

"I don’t think so. You two grew up together and in some respects treat each other like brothers and sisters so of course there’s going to be a bit of good natured needling. But in any good friendship there should be a serious sharing of thoughts and feelings. I’m not telling you what to do but If I were you next time Alex visits take him out to dinner. Wow him with how much of a wonderful young woman you’ve become."

Elizabeth had a mental image of her sitting down at a restaurant table with Alex and sharing a candlelit dinner. The image made her smile. What a ridiculous thought!

Kat saw what her daughter was thinking and commented "All i’m saying is open up to people. This Angela sounds fun, start sharing with her, do something impulsive for a change. Sure you can have picnics by the river and that’s an important part of a friendship but you need to move on. Do you know how you prevent becoming the reincarnation of the hell bitch?"

"Kill myself?" Elizabeth said cynically.

Kat gave a concerned look at Matthew, "If you tried that I WOULD be worried. No, you start by sharing with those you trust. Then when the hurt comes you are prepared for it, it will hurt but you will have the friends around you to help you out. Notice that Dr Bexley had no real friends before she met Cathline and Matthew. When the hurt came she reacted like a spoilt child. Before Matthew jilted her she’d never been wounded before. For a woman of her obvious intelligence she was very naive. Lizzy, put down your roots of trust in those you love and care for. Us, Auntie Cathline or anybody you feel you can lean on when the tough times come."

Now it was Matthew’s turn to say something, "Your moms right. Start to live a little. Learn to trust more, learn to love more and learn that from the pain you emerge stronger and a better person than you were before."

Elizabeth thought for a few moments, "So you’re saying that we need pain, hurt and conflict in our lives in order to grow. If that’s the case why do people who are always getting hurt are in such a mess?"

Kat gave a smile. Elizabeth had nearly got it, "It’s a question of balance. The trick is, to work out the balance for yourself. And nobody, not even us can tell you where that is."

"I need to work this out for myself right?" Elizabeth questioned.

"Fraid so little mite," Matthew quipped.

Elizabeth sat in silence for a minute or so. Her parents were right. She had to take the next step but why was she so afraid to?

Again Kat read her thoughts, "Scary isn’t it? Let me tell you something. When I knew your dad had been turned into Dr Bexley it’d scared me so much I didn’t know what to do. Sure I was as mad as hell and sure I was concerned for his safety but one thought I remember going around and around in my mind was ‘Yes I love him but can I go thru with this?’ I spent the days leading up to Xmas in my old house in mourning for what I’d lost. Although I might learn to love again I knew deep down it wouldn’t be the same. I don’t know how to describe how Matthew and I feel about each other but the only term I know that fits is ‘soul mate’ I feel as though Matthew and I have waited throughout all eternity to meet each other. It was that depth of feeling that drove me to stand by him no matter what. But to reach that stage I had to take it one step at time and do whatever it took to get there."

"I guess so mom. I’ll try." Elizabeth said softly.

"That’s my girl. Kat I think it’s time we were going," Matthew said with smile.

Angela walking in interrupted the conversation. On seeing Matthew and Kat she almost took a step backwards in surprise.

Kat cast her eyes over Elizabeth’s roommate. She was nearly as tall as Elizabeth was and had a similar shaped face. Her hair was raven black and a pair of intelligent looking green eyes looked back at her. It took a few moments for Angela to register and then she held out her hand, "Hi, you must be Elizabeth’s parents?"

"This is Matthew and I’m Jane," Kat replied returning Angela’s handshake.

"Elizabeth been dishing the dirt on me has she? How I never tidy up, always leave my clothes in a heap on the floor, and convince her to have her hair chopped short," Angela said with a warm smile.

"If you can convince Elizabeth to do anything she doesn’t want to do then you’re better than we are," Matthew joked.

"Dad," Elizabeth complained as though she was still fifteen.

"Elizabeth, we’re in New London for another day. I’m told there’s a direct train into Kings Cross. Should only take an hour. We’re staying in the penthouse of the Langam Hilton. We’d love it if you’d join us for dinner tomorrow. Angela can come too if she wants," Kat offered.

"Thanks mom I’ll come. Angela you want to meet the ‘olds’?"

Elizabeth asked.

"I think I’ll pass. It’s about time I did some work," Angela commented.

"But Angela, this is the Langam Hilton. Think about it—world class food, health spa’s, rejuv-sauna’s everything. It’ll be great," Elizabeth pleaded.

"You’ve got the brains to cruise all year, I’m afraid I haven’t. Mr and Mrs Stephens thank you so much for the offer and if it were last week then I’d be there already."

"We understand. Maybe next time," Matthew concluded.

"Elizabeth, we’ve transferred a little bit extra into your account for you to buy something nice for the meal. See ya tomorrow about eight?, " Kat smiled at Elizabeth and gave her a hug.

"Bye mom, Bye dad," Elizabeth said and gave Matthew another rib bursting hug.

"Maybe we’ll get chance to get to know you better next time. Nice meeting you Angela," Kat gave Angela a goodbye wave, Angela just smiled in return.

Elizabeth followed Matthew and Kat down the stairs and waved to them as they drew off in their hire car. She slowly walked up the steps and found Angela eating the last remaining null-fat chocolate bar.

"You could’ve been a little bit more civil to them?" Elizabeth complained.

"What?" Angela stated.

"They offered to treat you to a thousand Euro meal and you turn them down. Work my ass. You’re assignments don’t start until next week," Elizabeth sniped.

"I’d rather have had the money. Besides, you need to spend some time with them without me getting in the way. Tell me on a scale of one to ten, how anarchic are you feeling? Want to do something REALLY impulsive and downright stupid?"

"Why?" Elizabeth said suspiciously.

"Look at this. I thought we might go," Angela held up her PDA and showed Elizabeth the screen.

"WHAT! Have you lost your stupid limey brain?" Elizabeth almost shouted.

"It’d make the meeting interesting for them. Wouldn’t it?" Angela said with a mischievous glint in her eye. "Besides, we start work proper next week, we won’t get much chance for living on the edge for a while AND so the flyer says they have a special visit by the chief priest or whatever he’s called," Angela’s green eyes were gleaming with mischief and devil may care.

"It’d make me dead that’s what it would. You seriously expect me to walk into a Children of Bexley rally?" Elizabeth was incredulous. This idea was madness. Every fiber of her being hated the thought of going and yet a small part of her reveled in the sheer devilment of it.

"I’ve got this coat you can wear, it’s got one of those hoods. I thought we’d wait until they were in full flow. You would stand up to leave and accidentally let your hood drop. Imagine the look on their faces when they saw it was Dr Bexley’s look alike in among them."

Elizabeth’s mischievous part was now starting to assert itself, "But they hate mom and dad. They say it was their fault, that the whole thing was some con trick to get their hands on the hell bitches money. They would kill me or at least hold me hostage."

"Don’t be stupid—they haven’t tried yet have they? They’re justa harmless bunch of wacko’s. Let’s find out what they really think about you. I’ll set my PDA on instant alarm, and you can do the same. Come on, you know you want to. You can get them back for all the grief they gave you over your blood tests, mental profile, and every other test they forced you to have just to disprove them."

"Instant alarm huh. Payback’s a bitch isn’t it?"

"In this case, a hell bitch," Angela said with a smile.

What the hell Elizabeth thought and gave Angela a confirmatory smile.

Angela gave Elizabeth her spare coat and Elizabeth placed the hood over her head. It covered up most of her head and left only her blue-gray eyes showing.

"PDA set to instant alarm. Call emergency 211 in the event of my heart stopping or the next keypress," Angela said.

Elizabeth repeated the command. From a position of fear she was now basking in the thrill of the forbidden and downright dangerous. She had never done anything like this before. Normally she was so logical and precise but this was more impulsive than she had ever been in her life. The tingling sensation of fear was an addictive one. Her parents had warned her against having anything to do with the Children of Bexley cult. Elizabeth knew that her life as she knew it would be over if they found out whom she was really descended from. That’s what made this all the more thrilling.

They took the autobus to a small city called Ely, some fifteen miles from Cambridge. It was far enough away not to let the cult members know where they came from but close enough for a quick getaway if required. Elizabeth and Angela were silent during the twenty minute trip. Soon they were outside of an old car dealership in the middle of town. It had been converted into a meeting place and people were streaming in. Elizabeth could hardly keep herself from running back to the bus station. The butterflies in her stomach were multiplying with every step and it was all she could do to keep down a scream. Angela clutched hold of her arm and Elizabeth felt reassured that she was there.

As she approached the door she held her head down and took the paper flyer a well dressed man at the door passed to her. Her head still down she took a seat at the back and as far away from the ‘congregation’ as she could. By now there were about two or three hundred people of all walks of life. They were sitting down quietly waiting for the meeting to start.

"I want to leave," Elizabeth whispered to Angela.

"Shh it’s starting," Angela said and gave Elizabeth’s arm a squeeze. Elizabeth’s nerves were catching.

One by one the people rose and clapped as a man dressed in a smart Armani suit walked onto the stage. His goatee beard was newly clipped and his blue-gray eyes surveyed the sea of people in front of him. Just looking at him Elizabeth could feel the charisma of the man. She knew that just by listening to his voice those of weaker will would believe anything he told them. There was something supernatural about his demeanor, and caught up in the rising tide of cheering and clapping, Elizabeth felt herself joining in. She cast a glance at Angela. She too had been unable to resist the groundswell of emotion pouring out into the room.

The man beckoned for them to sit and Elizabeth did so. She saw the man glance again across the room and she hurriedly avoided his gaze. The last thing she wanted to do was reveal herself. She decided she would sit tight and listen and then leave. It had been a grave mistake to come here.

Elizabeth felt Angela’s grip tighten on her arm once more. The man had started to speak.

"Thank you all for coming. It’s been a long trip for me and I know it has for many of you. For those new here let me introduce myself. My name is James Adams and I am currently the one honored to be called the leader of the Children of Bexley. From when I was young and my mother showed me the results of the second Bexley trial I knew that this woman had something to teach us."

"Yeah how to kill people," Elizabeth whispered.

"Shh this is fun," Angela said.

"Her life was an extraordinary testament of triumph over adversity. We all know the records of the Fury have been tampered with in order to protect those who robbed Dr Bexley of her inheritance. For those who are unsure let me put forward a few facts.

Firstly, If this DNA machine ever existed where is it now? Once invented things do not un-invent themselves.

Secondly the altering of a person at the genetic level goes against all known laws of molecular biology. For those that are interested you can pull down a detailed e-book on it.

Thirdly. It’s interesting that those who were so called affected by the Fury all received multi million dollar payouts without having to go thru the courts to get it!.

Fourthly, There are no records and biopsies of the so-called changelings. We have no one’s say so that they ever existed.

Fifthly the agent used to destroy Tel-Aviv was not a genetic warhead but a highly corrosive acid, condensed into a fine mist."

The man paused to let his facts sink in. "He’s right about the DNA bit," Elizabeth stated, "Nobody’s ever worked out how Dr Bexley managed it."

"Then there’s the sixth fact. The use of prosthetics and cosmetic surgery was nearly as advanced as it is now. The only way a double of Dr Bexley could be created was by use of those methods."

"Angela I want to go now," Elizabeth stated.

"Not yet, I’ll give you the nudge," Angela whispered back.

"Anyway I hope I have given you enough to think about. There are about another twenty or so facts but I won’t bore you with them Use your PDA’s to get to http://www.come.to/children-of-bexley and read all the evidence for yourself.

You’ve seen the pictures of Matthew and Jane Stephens on the campaign trail with senator Jameson. What a fine upright couple they make. So would you if you had used the deviousness of the devil to rob an innocent woman and kill her parents on their way to a mercy mission."

Anger grew inside Elizabeth and she could take no more. It had been a mistake to come here. Not for her safety, but this whole charade was a gross insult to the memories of those who had been killed. She felt Angela pull her down but she shrugged off her arm.

"THAT’S A LIE!" Elizabeth roared and flung her hood back. Her face was red with fury and her blue-gray eyes had a murderous glint in them.

The man on the platform looked shocked for a moment and Elizabeth felt every eye in the room turn and face her. Those eyes widened and gasps of shock echoed around the room. The man had already composed himself and said in his most persuasive voice, "Tell me your name child"

"My name is Elizabeth Cathline Stephens and what you just said was a perversion of the truth and an insult to everyone who died trying to stop your precious Dr Bexley," Elizabeth’s voice was a quiet menacing hiss.

Angela looked up at Elizabeth. She had seen pictures of Dr Bexley and now Elizabeth looked as murderous and as deadly as her late namesake ever did. She felt a cold shiver run down her spine. What had she done?

The man said in his most placating voice, "Ladies and gentlemen we are greatly honored tonight. The daughter of our revered mother is here amongst us. Please join me in showing your true feelings."

Elizabeth put her hand into her pocket, ready to trigger the PDA, but saw to her amazement that the man on the platform had got down on bended knee. One by one everyone in the room save Angela was kneeling in front of her. Elizabeth could hear the whisperings of "Blessed mother thank you" and "Welcome daughter of the most high mother". The chants of praise to Elizabeth grew louder and louder and Elizabeth felt her soul rise with the sound of her praise. It was a feeling like none she had ever encountered. Elizabeth found her arms outstretched as if accepting all the praise that was being directed at her. It was an intoxicating feeling and one that Elizabeth never wanted to end.

Before things go too much out of hand Angela stood up and dragged a mesmerized Elizabeth out of the room and onto the street. Away from the chanting Elizabeth’s head cleared, "What the fuck was that," she swore.

"You tell me? They were worshipping you!" Angela exclaimed

"Cool wasn’t it! Promise me one thing," Elizabeth asked

"What’s that?"

"I don’t EVER want to go back there again, " Elizabeth muttered. The feeling of anger had left her elated and the praise as though she were some goddess had left a hook in her that she found she didn’t want to remove.

Elizabeth was sullen on the bus back to Cambridge. She didn’t want to explore the feelings that the meeting had awakened in her. The feelings of power, of being an unstoppable force of destiny and of hurt simmered inside her. How dare they call her parent’s murderers and thieves?

"Elizabeth I’m sorry. I thought it’d be a laugh. I don’t know what to say," The image of Elizabeth in full fury was imbedded in her mind.

"You don’t have to say anything. How can they believe such things? You’ve met mom and dad did they seem like they had arranged the murder of someone’s parents just to steal some money? I don’t get it, they’ve never done anything to harm anyone, why pick on them?" Elizabeth’s anger was slowly turning to sorrow and confusion.

Angela grabbed hold of Elizabeth’s arm and moved closer to comfort the now crying Elizabeth, "Of course they’re not. People are odd and do things we might least expect and want them to. You’ve known what these people believed from when you were young it can’t have been that much of a shock to you."

Elizabeth felt comforted by Angela’s arm on hers. She put her head on Angela’s shoulder feeling her smooth hair against her head, "Hmm you’ve been using my shampoo again."

"Guilty," Angela retorted, "I’ve just had a thought. You knew about this at an intellectual level but never at a personal one. Anyone else would have just walked out or at least said your piece and then walked out. Why did you stay? If you hated it so much why did you stay there and lap up their worship as though you were really Dr Bexley’s daughter?"

"Look if you had four hundred people singing your praises I’m sure you’d be flattered," Elizabeth retorted. The feelings of exhalation were beginning to surface again. Elizabeth quickly put them down and continued.

"Maybe but you sure as hell enjoyed it. I’m so sorry I put you through that. There was one moment when you looked so much like the ‘hell bitch’ it ran my blood cold. I’ve seen photos of her and up until that moment you looked like her, same eyes, nose everything but you had a certain air of naivete about you."

"Now what do you see?"

"The naivete has gone, at least for the moment. Don’t worry too much you’re probably tired," Angela comforted Elizabeth once more. She could feel Elizabeth’s gentle crying on her shoulders and it was all she could do not to join her. She was responsible for the shattering of her friend’s innocence and nothing she could think of could make her feel better about it.

They walked back arm in arm. Well, Angela was nearly carrying Elizabeth along. Elizabeth’s eyes were red with tears and her normal upright, confident stance had gone - replaced by a despondent stooping walk. They arrived back at the apartment and Angela unlocked the door and walked inside. She switched on the coffee machine, retrieved some ice cream from the cooler and handed Elizabeth a bowl and a spoon.

"What’s this for? I just want to go to bed," Elizabeth said, starting to get up.

"No you don’t, not yet," Angela stated

"Make me," Elizabeth whispered.

"What can I say to make this better," Angela asked.

"Goodnight Elizabeth."

Angela had an idea. It was only a glimmering of one and it would require a leap of faith on her part. "Elizabeth, I want to tell you something. "

"What’s that?"

Angela looked right at Elizabeth and said softly, "I know the reason why you are so hurt about tonight. You’ve never trusted anyone, ever. The only people you trust are your mom and dad and they’re a safe option for you. You know they love you and will no matter what. When that guy said what he did about them for a moment, just for a moment you believed him. Even the trust you had built up for your parents wasn’t enough to make you doubt them when faced with a charismatic speaker of some dumb cult. That’s why you got hurt. You are ashamed of yourself for believing him even for a moment, ashamed of enjoying all the praise you were getting and shit scared that you might turn out like the hell bitch. But there’s no way you can, the tests proved otherwise."

Elizabeth stayed silent. If only Angela knew the truth. She sought to divert Angela away, "Mom was telling me the same thing today. You’re right, I need to trust someone, open myself up to someone otherwise every single bitchy comment or lie will get to me right here," Elizabeth pointed at her heart.

Angela sat down beside Elizabeth and made eye contact with her, "Let me be that person. I don’t know what it is but we just connect you’re becoming like a sister to me. Here I’ll go first. This is a secret that nobody except my parents know. If it got out I’ll lose my grant money, everything so I trust you with it. Fifteen years of work and sacrifice by my parents will be wasted if this gets out."

"What is it?" Elizabeth asked. She felt relieved that Angela had made the first move.

"I’m adopted. My parents never registered me with the authorities. They were afraid I’d be taken away from them if they did. They got a forged birth entry and everything for me. If this were ever found out I’d lose my grant and my parents would face jail. They found me in the park, I was barely a few hours old and nearly frozen to death. They took me in and raised me as their own. I’ve no idea who my real family is or was but they obviously didn’t want me. Now mum and dad are the only family I have or even want."

Angela’s open admission had taken Elizabeth by surprise. What she had just told her put her in a position of power over her. Just one small slip and Angela Holden and her family were finished. Elizabeth felt extremely flattered to be told such a thing. She thought back what she’d been told about her mom and auntie Cathline’s friendship. How it had grown in a short space of time to the point where it was nearly has strong as that between hers and Matthew’s. Kat was right, it was about time she trusted someone else. But could Angela be trusted with her darkest secret? Elizabeth considered the options, of any one she had met, even Alex; Angela was the one person who had left herself vulnerable to her. It was a big step for Angela to take and just maybe it was time for her to take one of her own.

Elizabeth took a deep breath "Angela, what I’m about to tell you is so secret that only three people in the world know about it. In the same way as your life would be ruined if I told anyone about your adoption then mine would be also. I would become an exile, shunned by everyone I met and probably have to live my life under armed guard."

Angela’s eyes opened in curiosity. What was Elizabeth going to say?

Elizabeth stood up, ensured that the curtains were closed and walked over to check that nobody was listening at the door. She took her PDA out and started to write.

"You were right about my reasons for being scared and angry at the rally tonight."

"I knew that," Angela exclaimed.

Here goes Elizabeth thought and continued to write "All except one thing. Me being scared of turning out like the hell bitch."

"What were you scared about then," Angela asked?

Elizabeth shook her head as if to say wait and then continued to write, "I cannot turn out like the hell bitch, because I AM the hell bitch."

Angela stared at Elizabeth and started to back away, "No! That’s not possible! She’s dead! The tests!"

Fresh tears formed in Elizabeth’s eyes and she stood up and stood in front of a very shocked looking Angela. Elizabeth continued to write.

"Of course she’s dead! BUT every strand of my DNA is the same as HERS."

"But I was told you were a clone of your dad?" Angela replied

Elizabeth scrubbed the writing from her PDA and started to write on a clear screen, "That too was falsified. My dad has an IQ of around 120 while mine is over 160. My brain is exactly the same as HERS, right down to the same flaw that triggered the fury. As for the tests they were rigged in order to cover this up. That’s why I was worried about the rally. If it can happen to HER it can happen to ME!"

"I don’t believe you," Angela was nearly in tears. She had opened herself up, laid herself bare and now was Elizabeth lying to her?

Elizabeth spoke for the first time. Her voice shaking and full of apprehension, "Believe it, " she walked into her bedroom and came out a few seconds later with a bottle of small white pills. "What’s this?" she asked.

"Your asthma medicine. You take it every day," Angela replied.

Elizabeth shook her head and mouthed "Olanzapine"

It was the last word Angela heard before she fainted. The combined trauma of the last few hours, the extreme tiredness she felt and now this revelation was just too much .

o—o—o—

Kat was unable to get to sleep, in spite of her plush surroundings she was finding it hard to get comfortable. She was worried about Elizabeth. She just hoped she’d done the right thing by telling her to trust more, step out in trust to someone and to be a little bit more impulsive. She couldn’t help but worry Elizabeth might do something stupid and ruin everything.

Cathline was due to visit next week and perform her usual counterbalance role. Their bringing up of Elizabeth was entering its most crucial phase, the transition from a girl to a woman.

Her fears were allayed a little by Elizabeth’s room mate Angela. She seemed to be level headed and just the person Elizabeth needed to trust. Kat wasn’t really worried about Elizabeth becoming another Dr Bexley it took an extreme situation to trigger than off, it was more the other side of Elizabeth she was concerned about. Elizabeth’s emotional immaturity was the main issue. Elizabeth had never loved or even had a romantic relationship with anyone. The fear of them hurting her or the other way around ran deep in her. In a way, Kat thought that was their fault. They had hammered home what might happen for so long, had they stifled Elizabeth’s emotional growth?

Kat considered that they had, probably out of their own fear put the fear of God into Elizabeth about her true mother. Should they now withdraw more and let things take their own course? That certainly seemed to be the preferable option. Keep an eye on her and drop in from time to time. Kat though she needed to take some of her own advice. She had to learn to trust that Elizabeth knew what she was doing. Kat checked the bedside clock it was nearly 4am she really must try and get some sleep.

o—o—o—

Elizabeth awoke early the next morning. After carrying the still unconscious Angela to her bed she had just managed to make it to her own bed before collapsing in a heap. That had been one hell of a night! Had her admission ruined the blooming friendship between her and Angela? There was only one way to find out.

"I thought I’d make you breakfast in bed," Elizabeth said carrying in a tray of muslei and a steaming hot cup of coffee.

Angela sat up in bed and took the tray, "Thanks, you needn’t have."

"We need to talk. Not here, somewhere private. Look about last night, I...," Elizabeth started.

"It’s ok. I was just a little shocked that’s all. Let me eat this, throw on some clothes, and we’ll go out for a walk,"

"Deal," Elizabeth smiled. That had gone easier than she expected.

Elizabeth decided that she needed cheering up so she fished out her best Beckham-Kline outfit, straightened out what remained of her hair and applied some makeup. It felt good to feel smart for a change. This living in jeans, cheap skirt-pants, and sweaters was making her feel less like a woman and more like a garage sale.

Angela emerged wearing her standard issue jeans and T shirt she took a mock step back in amazement as she saw Elizabeth standing there looking like a million dollars. From the cut of her skirt-pants to the exquisite cut of her blouse Elizabeth looked every inch the millionaire’s daughter. Angela had never noticed before how Elizabeth’s face had an air of supreme confidence about it, of infallible intellect and of determination to succeed at any cost.

"Ready?" Elizabeth asked.

"You look, you look amazing. I need to change," Angela stated, and turned to go into her room.

"No you don’t! I just wanted to give the non-dowdy me an air, that’s all. Come on, let’s go, I’ve got a lecture at 11." Elizabeth smiled and beckoned for Angela to follow her.

They talked about this and that and Angela nearly blurted her coffee out when Elizabeth told her that her outfit had cost about twenty thousand dollars. To Angela it rubbed in the gulf that was still between them. They reached a secluded cake shop and sat down outside. The summer was wearing a bit thin now but even in this early October day it was pleasantly warm. Elizabeth had gotten wolf whistles and looks from nearly every man they passed. Angela decided that dressing this way was Elizabeth’s attempt to feel normal again. As they sat down and waited for the croissant’s to arrive Elizabeth asked, "Well?"

"Well what?" Angela replied taking a sip of her cappuccino.

"Last night. We need to clear the air. I need to know where we stand?"

"The same as before. I’m sorry for that fainting business—it made it seem worse than it is. I’m not worried about being stabbed while I sleep if that’s what you are concerned about. So my roomie is the hell bitches daughter. So what! You might have been gay, or even worse American!," Angela teased.

"But I am Amer...," Elizabeth started.

"I know you are. I just want you to know that you did the right thing telling me. You’re secret is safe with me. At least you know who your mother is. See, to me, it’s the environment you come from not which set of genes you have. Hell, I could be Dr Bexley’s illegitimate daughter for all I know BUT I do know that I was brought up very well and love my family. It makes no odds to someone who’s adopted which set of genes a person has. It’s who they are that’s the important thing and you young lady are far too well adjusted, clever and compassionate to ever be a hell bitch," Angela saw that her words had had the desired effect. Elizabeth now looked a lot happier than she had before.

"Thanks Angela. I was really worried when I woke up this morning. I was afraid I’d blown it both with you and with the whole cult thing."

Angela shook her head as if to disprove Elizabeth’s statement, "Now I understand why you reacted like you did. Hearing them talk about your parents like that and then them treating you like some kind of goddess must have really spooked you. Knowing who you are makes the whole thing ten times worse."

"So there’s not any part of you that’s the least bit worried about me?" Elizabeth asked.

"Listen witch, I am worried about you but not about the hell bitch thing,"

"Then what!" Elizabeth demanded.

"There’s a very cute guy over there who hasn’t been able to take his eyes off you since we got here and you haven’t even smiled at him," Angela smiled at Elizabeth.

Elizabeth gave Angela A big grin, the relief of being accepted for who she really was like a weight that had been lifted from her. At long last she was starting to feel free of the ghost of Dr Elizabeth Anne Bexley.

o—o—o—

Anne climbed up the ladder into the gently rocking boat. She had spent an exhilarating couple of hours taking samples of invertebrates and coral from the Med. They were always the first to feel the effects of pollution. Her re-breather was almost exhausted, as she was. It wasn’t the shell fish, coral and other invertebrates that gave her the buzz, it was the experience of freedom and of oneness with nature. Wearily she stripped off her wetsuit, revealing her bikini and tanned body. She walked into the laboratory area and saw Steve, her colleague poring over a computer screen.

"How’s it looking?" She asked.

"Not good. Fuel cell number three is playing up. I’m getting a ‘Main Bus B Undervolt’ warning light on the main panel. We should be ok for the trip back but I’ll go look at it in a while. As for the samples, Sulfur levels have risen by nearly eight per cent since 1992. Mercury is up too and as for the O2 content that’s down by four per cent. The Vesuvius eruption back in 08 didn’t help much. Most of this, what we’re seeing here, is down to that. But for these poor guys it doesn’t matter where it comes from. Only that it makes their life a lot harder," Steve gestured to the array of sample jars littering the lab table.

"I know. First of all the bacteria are affected, then the plankton, then the invertebrates and it just cascades down from there and before you know it the whole ecosystem has collapsed. We know what’s going on but with our current tech and funding we can’t stop it. There’s nothing we can do about volcanic activity but what we’re doing to the ocean sure as hell isn’t helping," Anne said bitterly.

"If what we think is happening here is actually happening then we may have a chance to save the ecosystem but it’ll take another twenty years before we can really start work. By the way, how’s the new re-breathers working out?" Steve asked. He cared about the impending collapse of the global marine ecosystems as much as Anne did but Anne was by far the more fanatical about it.

"Great! No mucking around with decompression, heavy tanks or worrying about running out of air. They must have cost a fortune. It’s nearly as good as having gills."

"And of course you’d know what having gills was like?" Steve teased.

"Ok I’ll let you go down next time ok," Anne said taking the hint.

Steve plucked up courage to ask a question he had been dying to ask since he first saw this tall, blonde and stunningly beautiful research student. Even after an exhausting two hour dive she glowed. Steve had to admit that there were elements of a younger Rachel Martin about her but Anne was far more realistic than that image of impossible female perfection.

"Anne?"

"Yep?" Anne replied. She was busy tying her hair back into its characteristic ponytail.

Here goes, Steve thought, "I was wondering if you’d like to have dinner with me?"

"I have dinner with you every day" Anne replied.

"No! I meant Dinner, candles, restaurant y’know."

"You mean a date?" Anne asked.

Now Steve was even more worried, "umm yes, if you like."

Anne gave Steve a smile, "How do you know I’m not some kind of nightmare cannibal surf babe? You know virtually nothing about me."

"But I want to find out. We’ve been working together for nearly six weeks and you’ve told me nothing about yourself," Steve stated.

"There’s nothing to tell. My parents died several years ago. I’m putting myself thru college using the money they left behind," Anne said. She was not sure at all if she wanted to get back into the dating game, let alone with Steve.

"Ok let me take you out as a friend then." Back to plan B Steve thought.

Anne had an impulsive thought, "No I’ll go as your date. It’s about time I had a little fun."

Steve couldn’t believe his ears, "That’s, that’s great! We’re due back at 6 so I guess I’ll pick you up at 8."

Anne gave Steve a devastating smile, "That’d be great. Now back to business. We’ve got to go back to the traps we sent just back on the continental shelf just off of Netanya. It should only take us a couple of hours to get there. That should give me time to recharge the re-breathers and to have a rest."

"Hey when is it my turn?" Steve complained

"Over dinner. I do the diving, you do the paying," Anne smiled.

Steve shook his head in mock disbelief. How could such a wonderful woman as Anne Baxter ever agree to go out with him? However unlikely it seemed, she just had.

o—o—o—

"Welcome Ms Stephens. Your parents are at a table in the garden atrium," the doorman gestured for Elizabeth to turn to the left.

Elizabeth gave the doorman a thank you smile and walked into the exquisite surroundings of the Langam Hilton. She felt just like the hotel looked, just like a million dollars. Her new outfit was absolutely stunning in conception. It hung on her as though suspended by an invisible thread, went in, and out in all the right places. The slit in the dress up her right leg exposed her shapely thigh, and the fact the dress left her entire back exposed save the curve of her ass made her the image of every teenager’s wet dream. Angela had been blown away by its elegance as she was picked by limousine from outside of her apartment. Angela had asked how much the outfit and hairstyling had cost but Elizabeth had refused. Fifty thousand Euro’s was a lot of money—all Elizabeth would say that it was enough. When getting dressed Elizabeth had noticed she was getting a little out of shape and vowed to spend at least two hours a day in the pool and gym to keep herself in tip top shape.

As she walked into the marble floored atrium she caught sight of Matthew and Kat laughing over a bottle of champagne. At the sight of her Matthew shook his head in mock disapproval while Kat just mouth "WOW".

Elizabeth smiled, she knew she looked wow. It made her feel better. A waiter saw her approach the table, and offered her a seat next to Kat. Elizabeth sat down, poured herself a glass of champagne and breathed a sigh of relief.

"You ok little mite?" Matthew asked.

"Just tired that’s all, " Elizabeth said, taking a sip of the still cold champagne.

"You could have saved some of that fifty grand we gave you. At this rate we’ll be broke and living in single roomed apartment in Delaware," Matthew stated.

"Sorry dad. Mom did say get something nice."

"I’m not telling you off but Angela must have felt awful. There aren’t many students who walk around in designer outfits or go to six star restaurants for meals," Matthew said.

They were interrupted by a very smart looking waiter who passed them the menus, swapped the bottle of champagne for a new one, and then retreated to allow his honored guests some time to consider their choices.

"Why come here? We could’ve gone to a place in Cambridge or New London?" Elizabeth asked.

Kat nodded, "Yes we could have but we wanted to give you a treat. We haven’t seen you for nearly two months and wanted the chance to be a real family again. We’re helping senator Jameson prepare for his presidential campaign, and so as that ramps up we’ll have less and less time to visit you. We’re sorry that we can’t spend all the time with you, but this is important."

Elizabeth understood that Kat was saying ‘you’re a big girl now’. She thought for a few moments, considered all the options and then said, "Mom, Dad, last night I did two very stupid things. Well one was very stupid the other hasn’t turned out too bad so far."

"What did you do? Did you have a fight with Angela?" Kat asked.

"Worse. Angela thought it would be a laugh if we went to a Children of Bexley Rally," Elizabeth said guiltily.

"WHAT!" Matthew roared, and then looked hurriedly around at the rest of the guests staring at them.

"I’m sorry dad. It seemed like a fun thing to do, to get them all wound up, get them back for all the grief they put us thru." Elizabeth knew she’d be in a for hard time but honesty was always the best policy, especially when parents were concerned.

"What happened?" Kat asked, the concern was evident on her face. "Did they hurt you?"

"No, that was the thing. We sat there and listened to their high priest or whatever he’s called. He started saying all these horrible things about you and I just lost it. I stood up and called him a liar."

"Then what did he do?"

"He bowed down and worshipped me. He called me Dr Bexley’s daughter. They don’t know, do they?" Elizabeth said worriedly.

"How can they know? Even a DNA test doesn’t give any hint of who you are. You have to combine a CAT scan with DNA tests in order to pick up the difference in yours and Matthew’s brain structure. We are the only people with that information. What on earth made you do such a stupid stunt?" Kat said, trying to placate Elizabeth’s concern.

"I was trying to step out in trust, be a little impulsive just like you said. Besides, I was getting too old and boring. I needed a thrill," Elizabeth said defensively.

"You get that side from your mother. Then what happened?"

Matthew quipped.

"Angela got spooked, I mean really spooked and dragged me out, then we went home."

"How did you feel when they said those things and when they were worshipping you?" Kat asked curiously.

Elizabeth had heard that tone several times before. It was Kat’s way of acting out of curiosity but not showing the deep heart felt concern she was really feeling. "I felt furious at them. I wanted to take them down for what they were saying about you and then when they were kneeling down in front of me calling me blessed daughter and all that I felt elated. It was as if I was being lifted up into the heavenly realms. Angela pulled me out before I was sucked in any more."

"Sounds as though she did the right thing. You have been taking your asthma medicine haven’t you?" Matthew stated.

"Of course. Look you guys would be mad if you heard what they said and to have four hundred people kneeling in front of you was, shall we say a unique experience," Elizabeth game Matthew a ‘come on I’m ok now’ kind of look.

"So what’s the second stupid thing you did?" Kat asked wearily.

"I told Angela who I really was. She’d opened up to me and told me her innermost secret and I need to trust someone. I’ve chosen her. Are you going to bawl me out about that one?"

Kat shook her head, "No. That’s a positive step. Not that you should be telling everyone, but we trust you’re a good judge of character. I am angry about what they accuse Matthew, Cathline and me of. To answer the other question, yes I would probably have hit the roof. Cathline certainly would. I wouldn’t worry too much about it. As long as you stay away from them you’ll be fine."

"Mom, Dad?" Elizabeth queried.

"Yep?" Matthew asked.

"I love you", Elizabeth said with a tear in her eye. They always had a way of making everything seem much better.

o—o—o—

"GPS makes the spot! We’re here!" Steve called out to Anne, who was busily attaching the small cylindrical re-breathers to the belt of her wetsuit.

"Ok. How far from the coast are we?" Anne called out.

"About forty miles, "It’ll take a couple of hours to get back but this shouldn’t take long. Fuel Cell three still playing up. I’ll have a go at fixing or replacing it while you’re busy with the fishes," Steve said. Had Anne forgotten about their date already?

"If we can get it going it’d be great. I’d hate to be stranded out here with a nice free meal waiting for me, "Anne smiled.

So she hadn’t forgotten. "I thought you’d be paying, seeing as your always saying what a twenty first century woman you are"

Anne gave Steve another heart melting smile, "I may live the third millennium but when it comes to matters of the heart, stomach and especially money I’m strictly second millennium."

Steve gave his best smile in return. It was going well. "Whatever you say dear. Now are we going to get those traps or not?"

"Ok. Want to check everything for me?" Anne asked. When diving alone the cardinal rule was to have someone else check you’re equipment and let them know exactly what you planned to do and go.

"Sure," Steve walked up and started checking Anne’s re-breathers, depth gauge, emergency air, a length of rope, shark repellant, and all the other gear she had on. He tried not to notice how snugly her wetsuit stuck to her skin or how the shape of her was as close to perfection as he could imagine. Now was not the time for distractions—someone’s life depended on how well he checked the equipment. A few moments later he announced, "You’re fine. See you in an hour. I’ll replace fuel cell three while you’ve gone. Bye."

Anne gave the ok signal and climbed down the ladder. After, clearing her mask, ducking underwater and testing the functionality of the re-breathers she gave Steve a last ‘ok’ signal and swam beneath the waves.

It took her almost twenty minutes to reach the crustacean traps they had laid a few days before. The plan was to catch a few lobsters, crabs or octopus and analyze them for signs of being affected by degradation of O2 in the water. One by one they were empty. That was odd, she thought they should have been mostly all full. Surely the population hadn’t degraded that much since the last survey was done a year ago?

After another five minutes she found two traps that contained a lobster each, so she untied them from the mooring anchor and went to inspect the others. They too were empty. She checked her watch; it was time to be heading back. She still had time to have a quick detour, Steve wouldn’t mind. This close to the sea floor there must be something interesting to see. She slowly swam downwards, thankful that she didn’t have to suffer decompression. She swam down until she could hardly see the hand in front of her face. Strange the water shouldn’t be this murky? She switched on the powerful flashlight attached to her wrist and proceeded to explore. What had caused this disturbance?

The water grew ever darker and more churned up as she swam on. Every instinct told her to withdraw. Don’t mess with what you don’t understand was the rule that had been drummed into her. She could feel her heart beat getting quicker and quicker until it seemed to make the water vibrate. She found herself hyperventilating. The re-breathers could only take so much oxygen from the water; if she didn’t calm down she would overload them. She stopped swimming for a few moments to calm herself down—after all the sea was her friend. It and she had been long time companions and she told herself that the bond between them would still be there. This had the desired effect and she then continued on. Suddenly she felt something touch her leg and almost screamed in shock. She whirled around to see what it was and saw only murky water. Steeling herself and overcome with curiosity she swam down to where she thought the object had gone. A few seconds later she saw a large object about six feet in length and very dim in outline. The current was gently carrying it away as though drifting on a breeze. She swam closer to it, shining the flashlight at it all times. Then, right out of the murky water leapt the burned remains of someone’s face. Its skin was almost all gone, as was most of the hair. Anne nearly spat out the regulator in horror. She recognized what remained of the face. It was Steve!

Putting aside her feelings as best she could she swam towards Steve’s body. She had to find out what had happened to him. Now knowing what to expect it was a little easier when she finally managed to get a clear glimpse of his body. A leg was missing, as was most of his chest. Her medical training kicked in, as did her scientific detachment. It was her defense against emotional trauma. Whatever had happened to Steve it had been quick and violent. It must have been some kind of explosion. Her heart sank; she now knew what had caused the water to be all churned up. There had been an explosion on board the boat, it had killed Steve, and as the boat sank it churned up the water around it. She was alone and stranded forty miles from shore.

Forgetting all about the lobster traps she managed to grab hold of Steve’s lifeless arm. She owed it to his family to try and return his body for them. Working as best as she could she tied the rope around his torso and attached the other end to her belt. Feeling the weight of Steve’s body behind her was making her progress slow, and it took her more than half an hour to reach the surface. Anne checked the re-breathers—they now had less than an hours worth of charge left to them. Anne looked around to see if she could find anything worth using as a life raft, but everything of any size had sunk with the boat. Flares, life rafts and everything were now making their way to the bottom of the Mediterranean. There would be no telling where or how deep it was by now. Judging by the lack of flotsam and debris there wouldn’t be much recoverable. She couldn’t even see the emergency mayday beacon that was supposed to deploy in the event of the ship sinking. Anne took her bearings from the sun, checked her wrist compass. There was nothing else for it. With no life preservers, rafts or useable floating material she would have to swim until she was picked up, made it to shore or drowned. There was one option open to her, it was an extreme one and very, very risky but it was she quickly decided, the only viable option left. Taking a deep breath she set out towards the shore.

o—o—o—

 

One Day Later

"That’s odd," Wills commented. Pointing at an entry on his PDA

"What is?" Mark asked.

"This dream woman of yours. She’s never been ill, gone to hospital, had a day off sick or anything," Wills stated.

"So?"

"Just think it’s odd that’s all. Look I’ve pulled down everything I

can find out about her, net white pages everything. Short of

spending all week at this you’ve seen everything about her that I

can find out,"

"Sure, thanks. I owe you one," Mark said. In the last hour or so he’d learned lots about his dream woman. Her real name was Elizabeth Anne Baxter. She’d lost both parents in an auto accident a number of years back. Her SAT scores and grades were way above average. She’d studied for a medical degree before switching to Marine Biology and Zoology. What else had he found out? That was it, she owned a late 2000 model year Porsche, very nice. No speeding tickets, convictions or anything. Average credit rating for a Ph.D. student, no outstanding debts. From what Wills had found out she was just a normal well balanced one hundred and ten percent babe.

"Mark I think you should see this. I was looking for any new information on her. Wills voice had dropped to a serious tone. He handed over his PDA to a worried looked Mark.

Mark stifled a cry of horror when he read the article.

"Two feared lost as research boat sinks with all hands.

Two promising students were feared dead when they failed to return from a routine survey of the Mediterranean. Steven Mercer(28) an experienced sailor and marine biology researcher and his assistant Elizabeth Anne Baxter(24) are feared lost when their boat ‘the ‘Anna-Maria’ failed to rendezvous at the agreed point.

Infra red detection and search and rescue aircraft were sent out after Israeli coastguards detected an automatic mayday signal. On reaching the last known position of the Anna-Maria, wreckage was detected on the ocean floor as were several smaller fragments floating on the surface. It is thought that the boat exploded due to a faulty fuel cell but the black box recorder has yet to be discovered."

"No it can’t be true. Not like this," Mark was looking distraught.

"What else does it say," Wills said softly.

Hardly daring to read on Mark continued.

"Divers were dispatched to investigate the wreck and as yet no bodies have been found. The search continues but is being hampered by bad weather."

"They haven’t found the bodies yet. But I guess it’s only a matter of time. I was so sure she was the one." Mark was now in a state of shock.

"Come on Mark, I’ll get you a beer," Wills said, helping Mark to his feet.

"I don’t feel much like a beer," Mark muttered. He felt as though he had been kicked in the stomach and that his life would never be the same again.

o—o—o—

Elizabeth flopped down on the bed after a hard day’s tutorials and lectures. The workload had suddenly hit them and neither of them had much time for picnics, cult visits or even just chilling out. Elizabeth of course had made light work of her coursework, but she had decided to read around the subject and was also assisting Angela in hers.

"When was the first successful use of stem cell regeneration for severe spinal injuries?" Elizabeth asked.

Angela smiled, knew this one "2001 on Detective Tina Cox. The late Dr Elizabeth Bexley performed the operation. She used stem cells to re-grow the damaged part of the spine, and so restore Detective Cox to full health."

"That’s not what it says here. It says a Dr Alice Woodward carried out the procedure on Robert Sykes in 2009."

Angela looked puzzled, "So what about Tina Cox? How was she cured?

"The late Dr Bexley injected her with a slow acting DNA modification drug which slowly regenerated her body. It needed to be slow acting because of Detective Cox’s critical condition."

Angela shrugged her shoulders "Ok. Fine."

Elizabeth read the next question from her PDA. "Ok, next question. Who postulated the ‘cold boot’ theory for the treatment of extreme personality disorders?"

Angela smiled she knew this one, "Dr. Yuri Kopaev of the Ivanovo State Medical Academy back in umm 2012."

Elizabeth nodded, "See you do know this stuff. Ok next question. What’s the theory?"

Angela shrugged "Dunno, something like you induce a deep coma and then when they wake up they’re better?"

Elizabeth read the answer from her PDA "Close enough. Pass me your PDA, and let me have a look at your gene sequencing work."

Angela sighed. Elizabeth was so much better at this than she

was. She reached across and picked up her PDA and passed it

to Elizabeth

"No the sequence goes ACTTGA not ACCTGA," Elizabeth was explaining to Angela.

"Why?"

Elizabeth was getting a little frustrated, "Did you go to the lecture? It’s all down to the proteins in the nucleic acid, that’s what makes it switch like that."

"I see. Sorry if I’m being dumb," Angela was finding the course hard going now.

"That’s ok. I guess I’ve guess I’ve just got a natural flair for this kind of thing. You wanna take a break?" Elizabeth asked. Angela was looking bored and frustrated.

"I’d better not. I need to understand this stuff before next week. Would you mind leaving me alone for an hour or so?" Angela said.

"I’ve a better idea come out for ice cream with me?" Elizabeth pleaded.

"No I have to do this?"

"Angela you come out with me and I’ll tell you my secret for doing all this genetics stuff," Elizabeth knew Angela needed a rest. At this rate she would burn out and that would be disastrous.

Angela resigned herself to Elizabeth’s pleading. Not that a nice ice cream would help things somewhat, "OK you win."

Ten minutes later they were sitting down in their favorite ice cream joint, waiting for two oddly named knickerbocker glories. "Ok then what’s your secret?" Angela demanded.

"Ah ah," Elizabeth shook her head. Not yet,

"I want to say sorry, "Elizabeth said softly.

"What for?"

"The other night. Waltzing around in that outfit like some spoilt rich kid. There’s you getting more and more wound up that you’ll fail your parents, and then me looking and acting like I own the place. Sorry," Elizabeth felt relieved. That thought had been on her mind since two days ago.

"I must admit I did find it odd. But don’t worry, if you have it use it. I know I can’t compete and I don’t want to either. I’m happy to be me. So if you want to blow fifty grand on an outfit, then that’s fine as long as you don’t expect me to match you, because I can’t."

"How’d you know the outfit cost fifty grand?" Elizabeth queried.

"You made the inside covers of one of the tabloids. It told me where you got it and how much you paid for it. I dunno how your parents have done it, but they do a good job of keeping your life private," Angela commented.

"I glad it is mostly private. I just give them a few photo’s every so often and it keeps them happy. Now I promised to show you how I do it," Elizabeth said.

"Go on. Is this how your mother did it? Angela asked.

Elizabeth wasn’t hurt by this comment. The thought had crossed her mind too and sharing with Angela would help the process, "I’ve no idea. I guess so. It seems so logical that it has to be the way."

"Go on then, I’m dying of suspense," Angela said eagerly.

"Ok then. I see the genetic structure in my mind. It’s like a 3D model. I can rotate it, insert and remove genes, proteins etc at will and picture the new form in my mind. It’s like when you listen to music with your eyes closed. You can feel the way the music will flow. I do the same with genetics. Actually I can do it with most other things. I use it for organizing my workload, decision making and planning. By using my mind modeling as I call it I can factor nearly all the permutations of a problem very quickly. I see the right path to take even before I’ve engaged my thought processes. If I process information like HER then it’s a good guess as to how she was able to out plan and out think everyone she encountered."

Angela closed her eyes and concentrated but nothing happened, "It’s no good," she complained.

Elizabeth thought of another way to try and explain it, "It takes practice. I’ve been doing it since the age of four. Look at this way. Mozart could ‘think in music’. ‘He didn’t think ‘I’ll stick a C flat there and then a B’. It flowed from him like writing does an author in full flow, like painting a masterpiece does to an artist. That’s what I’m saying. I can’t think in music but I can in permutations. Genetics is one long string of permutations, the fury was permutations of vengeance, what the hell bitch did to try and rectify that was a string of permutations as well. How she did what she did wasn’t mystical or superhuman she was just exceptional at this ‘thinking in permutations’".

Angela had a thought, "Are you as exceptional at it as she was?"

Elizabeth ignored the unsaid sentence in the question, ‘could you do what she did?’ Instead she answered, "In my opinion, and from what I’ve seen of her work before the Fury and at med. school I’m even better at it than she was," Elizabeth’s tone wasn’t proud or boastful; she was just stating a fact.

o—o—o—

"Mr and Mrs Mercer. The body is just thru here," the mortician gestured towards an operating table. The shape of a body lay underneath a white sheet.

The couple held hands, still in shock and fear as to what they might see. Slowly they walked over to the table and lifted the sheet. The woman let out a gasp and clutched her husband. His face was as white as marble and as emotionless as stone. He had just taken the shock in a different way to his wife. The man was the first to speak, "Yes doctor it’s him. We need a few moments alone. May we see the woman who recovered the body?"

"Sure take as long as you like. I’ll be outside when you’ve done," the mortician replied sympathetically.

The man nodded, "Thank you doctor."

In another part of the hospital a very tired, sun burned, and disheveled looking Anne Baxter was being quizzed by the police, coast guard, and accident investigators.

Anne was very tired and needed to rest and it was beginning to show in her voice "As I said before Steve had told me that fuel cell number three was playing up and he was going to change it while I retrieved the lobster traps. That was the last I knew until I

saw Steve’s body drifting away,"

"Did you see the ‘Anna-Maria’ when you were down there?" the coast guard asked.

"No I was running low on re-breather power and judging by the state of all the debris there wasn’t much left of it."

The police officer checked his PDA for the notes he’d made during the interview, "OK let me get this right. Your boat blows up."

Anne nodded wearily.

"You’re forty miles from shore with no flares, life boats or life preservers."

Anne answered "Yep"

"No fresh water, no food, limited time available to you for your re-breathers."

"Correct, officer," Anne replied.

"Officer, where’s this leading to? She needs rest, lots of it." The doctor who had given Anne the all clear now tried to stop the questioning. Anne needed rest desperately. The doctor was concerned. They had been questioning Anne for ages and she urgently needed her rest.

"Humor me doctor", the policeman replied. "Now where were we, Oh yes. If that’s not enough to handicap you you’ve got a 200 pound corpse tied to you."

"I guess so," Anne saw where this was leading to.

"So Ms Baxter please could you tell us how in hell you managed to swim forty miles, towing a grown man with no water, no food, no life preserver and no life raft. You then turn up, nearly two days later up at some fishing village very tired, sunburned but otherwise none the worse for your ordeal. That’s twenty miles a day for two days. Something doesn’t add up here," The policeman stated.

"Just what are you trying to say, officer?" Anne demanded.

The policeman continued his line of questioning. "Ok then how about this. You’re towing a half dismembered corpse, You’re a target for every shark or barracuda for a hundred miles yet the body is untouched and you haven’t a mark on you. How come?"

"Are you trying to suggest that I somehow blew the boat up forty miles from shore, leaving myself an almost impossible task to get back, and to add to that I tow my murder victim’s body behind me all the way," Anne was now sounding more and more outraged.

"Not at all, just tell us how you did it," the policeman asked.

"I’ve already told the coast guard, but I’ll repeat it just one more time. After that read the book," Anne snapped.

"Go on. The PDA is recording, " the policeman stated.

"Ok, first things first. I owed it to Steve to bring his body back to his family. I wasn’t there when my parents were killed, I never got the chance to say goodbye to them, and it’s that memory that has haunted me ever since. I still had a full compliment of shark repellant so I set it to slow release, just enough to mask the blood still seeping from him. To make it last longer I stripped off my wetsuit, placed the repellant inside his chest and put the wetsuit on him. That way he was as sealed in as I could get him."

"That was some feat doing all that without dropping anything," the policeman said.

"I did drop a few things. Which is why I was glad of my re-breather. Anyway, that was Steve dealt with. The next thing on the agenda was how in hell was I going to make it back to shore. As Mr Coastguard over there knows, over the past year or so the pattern of currents is slowly changing. It’s been playing havoc with fish stock, everything. Anyway because we were tracking the plankton we needed to follow the currents quite closely."

"I get it!" the coastguard exclaimed,

"Yep. I swam in the current all the time. The amount of effort required dropped from a forty mile swim down to a more modest thirty. To conserve energy I drifted, swimming only to maintain course. Halfway thru the first day I found a piece of wood large enough to put Steve onto. After lashing him to it I towed it like a raft. Steve didn’t need my wetsuit anymore so I put it back on. I needed it more than he did. Eventually I reached a small fishing village and managed to rise the alarm. Are we any closer to finding out what happened?"

The accident investigator shrugged. "We think it was the fuel cell. They were a very old design. Our initial guess is that cell three must have cracked open. It would have been ok, but Steve probably moved it when he replaced it. That could have released a large amount of hydrogen and oxygen into the engine room. All it would take is a spark from a light switch and the whole boat would have gone up. The other fuel cells would probably have split too, just adding to the destruction.

"I thought fuel cells were nearly indestructible and have multiple failsafes?" the policeman asked.

"They are and they do. I’m not an expert on this, I’m just reading what it says here. It’s probable that a manufacturing fault was to blame, and it only appeared when the cell was being swapped out. These things last for years so this may well have been the first time it had been swapped out. Anyway, at the moment it looks as though moving it caused it to explode. We can’t know for sure for a while yet. There’s not much left to look at."

The conversation was interrupted by a knock at the door. A nurse popped her head around the corner, "Anne, Mr and Mrs Mercer would like a word with you"

"It’s ok. I think we’re done here aren’t we?" Anne asked hopefully.

"I think so. We’ll come back tomorrow if that’s ok?" the policeman stated. Switching off his PDA and putting it inside his pocket. The other two men nodded their agreement, collected their notes and left the room.

Anne didn’t have much time to recover from her grilling, and in one way she preferred the all at once approach. She’d had little time to think on Steve and how exactly she felt about his loss. Her train of thought was lost as a couple dressed in somber fashion walked in holding hands. Anne stood up and asked, "Mr and Mrs Mercer?"

The man nodded, and sat down on the chair the policeman had occupied some moments before. "We’ve, we’ve come to say thank you," the man’s voice was cracking with emotion. His wife, her eyes red with tears sat studying Anne.

"That’s ok. I’m so, so sorry. I wish I had been there. Maybe I could have done more," Anne said softly.

The woman spoke for the first time. Her voice was quiet and shaky, "You did more than anyone ever expected you to do. Please don’t blame yourself."

"Jo’s right. You could have left him at the bottom of the sea but you risked your life to bring him back to us. We can bury him properly, say good bye properly and remember him, as we always will. You have given him back to us, and that is a dept we can never repay," The man said. His voice was now firmer and calmer than before.

Anne decided to open up to this people. They needed the answers to those questions, "When I was down there and saw his body. I could only think of when my parents were killed. I was away at the time and never got the chance to say goodbye to them properly. It still plays on my mind from time to time that I never got that chance. I knew as Steve drifted away from me that I had to save some else the same pain that I went thru."

"Thank you is all we can say. What was Steve’s mood like when you left him?" Jo asked.

Anne saw thru the question ‘Did my son die contented? Can I regard his life as happy one?’ "He was very happy. He’d asked me on a date earlier on in the day. I don’t date just anyone, but Steve was fun to be around and we got on really well so I’d agreed. We’d spent much of the rest of the day talking about it, him especially. I’ll always remember him in that way. Yes he was very happy when I left him"

Jo let out a small stifled sob and was immediately comforted by her husband who then said, "Thank you. Steve was a quiet and thoughtful son. He was always a little shy around women. The fact you agreed to go out with him would have given him more pleasure than you can imagine. It helps to think of him that way; getting ready for a date with you. I bet he teased you about paying, he always wanted to be the gentleman."

Anne gave a smile and nodded. Fresh tears formed in her eyes "Yes he did and yes he was, a perfect gentleman. You should be very proud of him. We had sent some unusual findings to the university. Well they were Steve’s findings. I did the diving, he did the studying. If they show what we think they show, we have a small chance to make a real difference. His life wasn’t wasted at all."

Jo looked Anne in the eyes, "No it wasn’t was it? It brought you to us. I’m sure your parents wherever they are would be very proud of what you did for Steve and us. Please come to his funeral. We want you to come."

"Mr and Mrs Mercer?" Anne said.

"Jo and Karl please," Karl replied

"Ok, Jo and Karl. I will be there, I promise," Anne said with such determination that Jo and Karl knew that nothing in heaven and earth would stop this remarkable young woman from attending their son’s funeral.

"They told us the boat blew up when Steve went to change the fuel cell, is that what you think happened?" Karl asked.

‘Did my son cause this?’ was how Anne took the question, "The fuel cell was old and probably had a defect that only showed it’s self when it was removed. That’s the line they are using at the moment. They don’t think there’s any causative action on it. The maintenance was up to date and it had all been checked. It was just a terrible accident. Steve wasn’t to blame, he always checked everything again and again."

Karl scribbled a note down on a scrap of paper, "Ms Baxter, here is our address in Utah. We’ll send you the funeral details as soon as we know them."

"I’ll be there," Anne promised.

"We know you will," Karl said quietly.

"We have to leave now, we have so much to prepare and it’s the hardest job in the world at the moment," Jo stated.

Anne nodded, "Thank you for coming. I appreciate your visit.

Thank you."

Jo stood up and gave Anne a large hug, "Thank you so much."

New tears formed in her eyes and Anne returned the embrace. The next few days were going to be very hard on Jo and Karl Mercer and they would need all the comfort they could get.

o—o—o—

The next day Wills, clutching his PDA ran up the five flights of stairs to Mark’s room. The elevators had been out of order and this couldn’t wait. Out of breath he managed to rap a staccato knock on Mark’s door. "Mark. Wake up, " he managed to rasp.

"Mog off!" Mark shouted thru the door.

"Mark open up. There’s some news just in," Wills called. He was slowly catching his breath.

Wills heard a shuffling sound come to the door and was faced with a bedraggled Mark. His hair was unkempt and unwashed. Deep dark rings were around each eye and his face looked as though it belonged to a much older version of himself, "Uh huh?" Mark grunted.

"Look at this!" Wills thrust his PDA into Marks face.

"I’m not in the mood for games," Mark snarled.

Unable to contain the news any longer Wills blurted "She alive. Your dream woman, Anne Baxter she’s turned up. A little sunburned, utterly exhausted but she IS alive."

"You what! Come in, sorry bout the mess," Mark said. His face showing distinct signs of unbelief.

Mark’s room was normally quite tidy for a single guy, but this looked as though it had been trashed by a drunken, but very angry heard of elephants. Clothes were scattered all over the floor, mugs were placed on every level surface. An empty Pizza box was on the floor, its half eaten contents was still visible as it was draped over the side of the box. Wills was a little stunned. He had never seen his friend like this before, let alone over a woman he’d never even spoken to.

"Mark, Listen to me. She’s alive."

"I heard that bit! How come?"

Wills righted a turned over chair and sat himself down on it. Mark swept an area clean of socks and underwear and sat down facing him.

Wills read from the PDA, "It seems a fuel cell exploded on her boat, killing this Steve Mercer instantly. She was diving at the time and literally bumped into his body. Uck!"

"And?" Mark demanded. His hopes were starting to rise from the pit of despair they had been in for the past few days.

"Her boat was forty miles from shore when it happened. Woah! She swam back to shore towing this guys body!"

Mark gave Wills an incredulous look, "She SWAM back? TOWING a guy. Fecking hell Wills, how’d she manage that?"

"Says here she found some wreckage, put his body on it and then used currents to drift back to shore. Oh yes, she’d put her shark repellant canister inside this guy’s body and sealed it in with her wetsuit. This prevented her from being attacked as she swam. "

Mark’s face dropped.

"Hey, what’s up?" Wills asked.

"She is way Way WAY out of my league. She’s out of league for anybody I know. I’ve spent some time diving and there is no way in hell you do what she did unless you are one hundred and ten percent sure that you are going to make it back. You know what the real neat point is? She towed the guys body back! I’ll say that again she towed the guys body back!"

"Your point?" Wills asked. He was failing to see where Mark was leading.

"Say that guy was average size and weighs about one ninety pounds. That’s an extra bodyweight you have to pull. Sure you’ll lose some when it’s floating but still. Yet she was strong enough to swim forty miles. After seeing this guy’s body underwater she doesn’t panic or do anything stupid. She sets everything up, works out what she is going to do, and then does it."

"Says here she walked out of the sea near a fishing village, As I said sun burnt, exhausted but none the worse for wear."

"And another thing. Aircraft were searching for them. They would follow the current as that’s the way anything would drift so why didn’t they see her?"

Wills shrugged his shoulders "Dunno."

"SEE what I mean! She’s fit enough to swim forty miles, resourceful enough to survive in those conditions, cool headed enough not to get attacked by sharks and she still has enough consideration and forethought for the guy’s family to bring his body back. As I said, way, way out of my league."

"There’s only one sure fire way to find out" Wills stated. He saw what Mark had been driving at. This was one hell of a woman.

"How?" Mark asked.

"Wait until the Uber babe comes back in a couple of months."

o—o—o—

 

 

One Week Later

Anne Baxter lay stretched out on her bed. Steve’s funeral was a little over a week away, and attending it was not a pleasant thought. Why did everyone she remotely like or care for die on her? Sure Steve may not have been husband material, but she did get on well with him. She closed her eyes and tried to access the part of her that could shut away the death of a close friend. She tried to suppress how she felt about what had just happened but found that the feelings of loss wouldn’t go away. Maybe she had been fonder of Steve than she had admitted to herself. Maybe it was just the grief and shock making her feel this way. She decided that a good compromise was that it was a little bit of both.

She reflected back on her survival of the sinking of the "Anna Maria". That had been a very stupid thing she’d done. The proper thing to do would have been to wait for rescue at the site of the wreck, not swim forty miles to shore just because she could. The reaction of Steve’s parents gave her some comfort. She had done the right thing by returning his body to them. It would make their grieving process a little easier, but what of her grieving process? Was Steve just another death to add to her list of those who had came in contact with her?

It was, she decided self-defeating to think like this. She and Steve had performed some important work during their time together and nothing could take that away from them. She did feel a little guilty about lying to Steve’s parents about Steve coming up with the idea that could not only remove much of the pollution from the world’s oceans but also provide an almost limitless supply of minerals. That had not been Steve’s idea, it had been hers. Where it came from didn’t matter to her, as long as it worked and she was as sure it would as she was that she could make that forty mile swim.

The thought of the work she still had to do brought back memories of the previous day’s conversation with the dean of Tel-Aviv University. He had given the usual platitudes of being sorry and how Steve would be greatly missed.

Anne ran thru the conversation in her mind.

"So what you’re saying is that I can’t go out anymore but I have to do the rest of my tenure here behind a desk?" Anne still felt annoyed even a day after the event.

"Ms Baxter. We have no more research vessels free and no vacancies on the ones we have. Until the insurance pays up then we cannot afford to buy and refit a new boat and even if we could, your time would be up before it was ready," The Dean was most insistent.

Anne still refused to give up, "But this is important. We were so close; even another week on board another ship would be enough. We lost all our samples, all the genetic material everything in the wreck. Steve managed to save all the work we’d done to the off shore archive otherwise we’d be back to square one. If you value his memory as much as you say you do then you’ll let me complete it for him."

"Do you want your Ph.D. or not? If you do then complete it back on shore. Otherwise you are free to go back to your college right now. You won’t even tell the head of faculty what you were working on, only that it’s a certain Nobel Prize. So how do I know that this isn’t just some excuse for you to go diving some more?"

Anne was getting exasperated. Why would no one trust her? "I’ve told him as much as I can. It’s to do with Plankton. Ok fine, I’ll work from shore but I’ll make sure that this university gets none of the credit for helping me avert the greatest environmental disaster the world has ever seen since the extinction of the dinosaurs!"

Anne smiled to herself. She had hit the Dean where it hurt, loss of prestige and therefore money.

The Dean still wouldn’t give in without a fight "Oh come on, Ms Baxter you’re exaggerating."

Anne raised an eyebrow in surprise, "Am I? Year on Year decline in Plankton reproduction, year on year increase in birth defects and sterility amongst the vertebrate and invertebrate population, year on year decreases in plant and coral life. This is all happening on a global scale. Within the next seventy to one hundred years we are facing almost total extinction of all complex life forms in all the world’s oceans. Ask Dr Bayan, he’ll verify what I’m saying is true. He’s looked over our data and is right now getting ready to pitch to the UN to do something. Because if the oceans die then we cannot and will not be far behind. Now I will get my research done someway or another. I’d rather it be here because all my notes and samples are here, but I can just as easily go to Australia and get it done," Anne had just left the threat hanging.

"And all you need is a week?"

"Maybe two," Anne had said.

"Ok you have your two weeks. Just make sure you’re right about this and damn sure this university gets a mention. You’ll replace Dr Quenby on board the "Esau" on Monday."

"Thank you, You won’t regret it,"

Anne gave a self-satisfied yawn. Today was Sunday, and tomorrow she would be back on board a ship; more importantly she could get back to the verification of her hunch. She was sure it would be met with uproar when it was announced but it was the only way.

Her mind wandered back to Steve once more. He would have been delighted at her result in front of the dean. It would be, she decided, a fitting memorial to him if she was able to pull it off. His death would not have been in vain and this thought made her sorrow more bearable.

"Hi-fi, Track 6 personal collection."

The small box in the corner beeped in recognition and started to play. Anne closed her eyes and listened to the haunting song.

‘Flying over to the U V A

Easy rider, she could dream all day, dream all day

Yeah, she’s heading all the way to the sun

Or far enough to get what she wants

Maybe she will, maybe she won’t

It’s easy to say, hard if you don’t

Flying, gliding to a slow decay,

Now is nothing when it’s yesterday,yesteday

Yeah, she’s heading all the way to the sun

Or far enough to get what she wants

Maybe she will, maybe she won’t

It’s easy to say, hard if you don’t

But you’ve got to make the most of today

For beauty dies young, beauty dies young

Yeah, she’s heading all the way to the sun

Or far enough to get what she wants

Maybe she will, maybe she won’t

It’s easy to say, hard if you don’t

But you’ve got to make the most of today

For beauty dies young

But you’ve got to make the most of today

For beauty dies young

You’ve got to make the most of today

For beauty dies young, beauty dies young

Beauty dies young’

 

o—o—o—

"I don’t think this will fit me anymore," Matthew said jokingly, pulling out a short nylon skirt.

"Nor this me," Kat joked back showing Matthew a pair of jeans with a hole cut out in the rear. That pair of jeans had been made for Kat when she was still living as the half tiger and half woman creature that Dr Bexley had turned her into, and the hole had been for her tail.

"Why’d we keep so much junk?" Matthew asked.

"Dunno. Elizabeth might like your old skirt though."

"Nahh, it’s not got a designer label on it. God, I hated wearing those things," Matthew stated.

"Not as much as I hated wearing those jeans," Now some twenty years after they had been turned back into their ‘proper’ forms they could now joke about it. Well almost.

"I’ve no idea how long I could’ve stood being a woman," Matthew said gently.

"As long as it took. Matthew, why’d we keep all of HER stuff from her old house? She’s not going to need it anymore," Kat said.

They had stored all of Dr Bexley’s personal belongings from her old house just in case any of it would prove useful. Now some twenty years later, the time had come to have a spring clean. Besides, maybe clearing out Dr Bexley’s old belongings helped take their mind away from their own daughter, so many miles away and so vulnerable.

Matthew shrugged his shoulders, "Seemed like a good idea at the time I guess. Just as well we’ve got enough space to store it. Y’know how it is stuff just kinda grows. It was your idea to have a clear out anyway."

"Too right!" Kat suggested.

"I think we should auction it off. It’ll make a bomb on E-Bay2, " Matthew suggested.

"And have all those Children of Bexley freaks fawning all over it? When Cathline next visits in a month or so we’ll let her read some of the journals. She’s into that kinda thing." Kat said. The last thing she wanted was to provide that cult with some more ‘sacred’ artifacts.

"Ok, We’ll pile all of HER stuff in one corner. All her books, clothes and stuff can go over there," Matthew pointed to a corner of the room that was less cluttered than the rest. What about our stuff?"

"Bin it I guess. It seems a shame to throw away all that history but it IS in the past and we need the room. Put it in the opposite corner to HER stuff," Kat suggested.

"Kat, I’m still worried about Elizabeth," Matthew said. He’d been waiting for the right moment to voice his concern.

"Me too. We’ve done all we can to ensure that she turns out alright. Now it’s up to her," Kat said softly.

"You think we should tell her?" Matthew suggested.

"Nope. If she knew it would destroy her. It would ensure that she really would fail the test. We have to trust her and ourselves."

"I’d hate to lose her," Matthew said sadly

"Me too," Kat said and gave Matthew a comforting hug. It had to work out with Elizabeth—it just had to.

"This is getting much too serious. Hey Kat, you think I’d look sexy in this?" Matthew said pulling out a black silky teddy.

"Of course darling," Kat rummaged around for a while and then spotted a small booklet. She fished it out and showed it to Matthew. "You should have read this first, it might have helped."

Matthew read the cover of the booklet ‘Yamaha GP1200 R Jetski instructions and guidelines’. "Very funny. I can whip your butt any day of the week."

Kat gave a smile. She had comprehensively beaten Matthew in every Jetski race they’d ever had. All except one when she’d run out of fuel. "Like hell you can."

"Wanna bet. I’ll order some new ones up and we can resume where we left off."

"Ok Let’s finish clearing this up. Elizabeth will be back in a month so you’d better order three. You’d better get used to finishing last though," Kat smiled at Matthew.

"In case you haven’t noticed I’m not a wussy girlie anymore."

"I certainly had," Kat gave Matthew a seductive smile and moved in for the kiss. Matthew responded in kind and soon any thoughts of clearing up were forgotten.

o—o—o—

"Elizabeth, That guy over there is still looking at you," Angela hissed.

"That he may be, but I’m not interested," Elizabeth replied. The guy was cute, real cute though. He was, she estimated, a clean six foot, his short cropped blonde hair was neat and his blue eyes took in her every detail.

As if reading her thoughts Angela said, "Look. He’s the cutest guy in the room. Go talk to him."

"No," Elizabeth said flatly.

"Don’t turn round, but he’s coming over," Angela whispered

Elizabeth froze. That’s the last thing she wanted. Even if the guy was cute. She heard the man’s footsteps draw closer until he pulled up a chair and spoke.

"I’m sorry for staring at you like that."

Elizabeth was a little taken aback, "That’s ok." She muttered.

"Thanks, " The man said and stood up to leave.

"Hey," Elizabeth called. Nice ass Elizabeth thought.

The man turned around, "Yes?"

"Why were you staring at me? Don’t give me any of this most beautiful woman in the room crap either", Elizabeth said forcefully. Her blue-gray eyes showing flashes of defiance.

"Bugger, That was my one good line gone," the man joked. His English accent had a clipped BBC tone about it. It was strangely alluring to Elizabeth.

Elizabeth nearly smiled back but stifled it down.

"If you must know I was wondering where you got your lipstick, sorry, lip gloss from. I think it’d suit me." The man’s face showed amusement.

Now Elizabeth couldn’t help but smile, "Actually I think you’re more a deep red kinda guy than this light plum. Blue eyes and deep red definitely go together. I’ll give you my stylists card if you want," Elizabeth moved a hand towards her purse.

The man was a little taken aback, "Ok, Ok you win. My name’s Nick and you are?"

Didn’t the man read magazines? Elizabeth thought, "Elizabeth."

"Elizabeth, nice name. Who’s your friend?"

"Angela. Actually, Elizabeth here was telling me what a cute guy you are", Angela said.

Elizabeth shot a soul piercing glare at Angela, but Angela ignored her.

Nick caught Elizabeth’s glare "Thanks. What are you going tomorrow? I’m doing a study on how our best friends can be our worst enemies and I’d like your input. Meet me by the river at say eight?"

Elizabeth considered his offer. Angela wouldn’t rest until she’d set her up with some guy at least for one date. She decided that Nick was at least a little amusing and seemed like a decent sort. After all it was only one date. "Sure why not. I hope you’ll use real names to protect the guilty."

Nick gave a smile showing a perfect set of teeth, "Deal. Angela

you are in for it big time. Until tomorrow then,"

Elizabeth gave Nick a stunning smile, "Deal."

o—o—o—

Elizabeth had now been dating Nick for the past three weeks. The first date had gone better than she expected, and in spite of her initial reservations she found Nick fun to be with. He shared her slightly off the wall sense of humor and was even quite a good cook. Elizabeth had originally bawled Angela out over her overt matchmaking but had now conceded that it was a good thing. She had politely declined Nick’s serious advances saying that she preferred to wait. Nick was fine about this too.

Nick was studying cybernetics at the Gates College of advanced technology. It was a subject Elizabeth found a little dull, preferring the infinite and intricate possibilities of DNA and medicine. Elizabeth had to admit that some of the theories and hardware that were being mooted were seriously cool. Implants in the brain that acted as additional memory, implants that automatically translated any language into any other language and enhanced replacement limbs that were just as or even more dexterous than the real thing. If he weren’t careful Nick would go on for hours about it. Elizabeth would just sit there and listen intently, studying his rugged face or contemplating how it was that she was slowly but surely falling for him?

It was nearly the end of the semester and Elizabeth was wondering what it would be like to leave Angela, Nick and all her other friends behind for a month or so. She would miss them and Angela had declined her invitation to visit her for a while. Angela missed her parents too much even though they hadn’t visited all semester.

Elizabeth was sat in front of her PDA, reviewing her end of term paper. Angela was out, at the library or doing something else. Elizabeth had just read a complex DNA sequence when she heard a knock at the door. She recognized the knock. It was Nick!

Elizabeth shot up out of her chair and flung open the door.

Without waiting for Nick’s greeting she flung her arms around him and gave him a large hug. "Hi"

Elizabeth got a little worried when Nick didn’t return the hug.

"Can I come in?" Nick said solemnly.

Elizabeth’s heart was in her mouth. What could be wrong? Normally Nick was outgoing and witty. It was those qualities Elizabeth liked in him.

"You’d better sit down," Nick said softly.

Elizabeth did so, a feeling of dread was inside her.

Nick’s face dropped "There’s no easy way to say or do this so I’ll put it bluntly. Elizabeth, it’s been real fun getting to know you. Even better going out with you but I’m afraid I can’t go out with you any more."

Elizabeth felt liked she’d been hit with a lump hammer and kicked in the gut at the same time, "Why? Is it me?"

Nick reached out and clasped Elizabeth’s hand. She went to pull away but Nick looked her in the eyes and she stopped. "Liz, it’s not you. Please don’t ever think it’s you. You’re beautiful, witty, far more intelligent than I am and I’m sure there’s somebody out there for you. It’s just that, that someone isn’t me."

Tears formed in Elizabeth eyes, "You didn’t answer me", she snapped.

"Hey I’m about to. We’re in different worlds. You turn up to our first date wearing that 50K outfit of yours, and I turn up wearing my best pants and shirt costing all of 100 Euros. Next week you’re off to your own island while I go back to my parent’s semi in Basildon. How can it work Liz? I wanted to do this now before it got serious and we both got hurt even more."

"I thought we were serious!" Elizabeth sobbed. Never had she felt hurt like this before. Could nothing replace the empty space inside her? The word she’d heard Angela use when she’d got a low mark on an important test was ‘gutted’. That was exactly how she felt now. As though someone had ripped her heart out and left it beating on the floor.

"Liz, please I still care deeply for you. But it wasn’t just the gap between us. Where were we going?"

Still crying Elizabeth managed to say, "I wanted a chance to find out."

"Sorry Liz. I’m not some kinda dump and leave kinda guy. I wanted this to work out as much as you did. But it wasn’t to be."

Elizabeth gave Nick a glare that shook him to the core. It was a glare of such venom and fury that he almost wilted under it, "I think you’d better leave?"

Nick still a little shaken by the ferocity of Elizabeth’s demeanor stood up and turned to leave. His heart was pounding at the sight of those blue-gray eyes boring into his soul. They were almost demanding blood in return for the pain he’d just inflicted. A fear crept through him until he fled from the room. What had he just done?

He could still hear Elizabeth’s sobbing as he slammed the door shut more in fear than anger and made his way down the corridor.

o—o—o—

Nick was still upset with breaking up with Elizabeth. He had tried his best to make it as painless as he could for her but he felt as though he had messed the whole thing up. She just hadn’t understood what he was trying to get at. He knew that she knew that his reasons didn’t hold water but how could he have told her that there was someone else?

It was, he decided better that he lie to her rather than tell her the truth. The real truth was that he had met someone a week or so ago but couldn’t face telling Elizabeth about her. She was everything Elizabeth wasn’t. She had a fire about her, she was from a normal background not some celebrity rich kid, and furthermore she didn’t creep him out as Elizabeth had so often done.

Yes, he decided he’d done the right thing. Elizabeth was one scary woman. She could run rings around him on the intelligence front, always seemed to know what he was going to do before he did it, and as for that ‘look’ she gave him, it was right from the depths of hell and fury. That didn’t mean she wasn’t fun to be around or that she wasn’t a nice person. She was. She had compassion, wit, integrity and wisdom, but was also a little aloof and austere.

Nick regretted the way in which he had had to break up with her. Maybe he should have told her, but he knew that would hurt her more in the long run. It was too late now. He just hoped that Elizabeth would get over him and that she could move on. He did feel a rat cheating on her like that but how often does true love come along, once in a lifetime? He hoped that in the long run Elizabeth would understand.

o—o—o—

Elizabeth had been inconsolable for three days. Angela had tried all the tricks in the book to cheer her up, from ice cream to slushy movies. Now with only two days to go before the end of the semester it looked as though Angela would be leaving Elizabeth just when she needed her the most. Angela’s patience was starting to wear a little thin with Elizabeth’s introspective moping. "Elizabeth, I hate to say this but get a life. Men are bastards, we all know that."

"You get a life! I don’t see you with many boyfriends!" Elizabeth snarled, and gave Angela another one of her soul piercing glares.

Elizabeth’s comment stung Angela but she shrugged it off. "That’s because I’m too busy working and trying to pass my course. At least Nick had the decency to try and be nice to you. He tried to spare your feelings as much as he could."

"You don’t believe his reasons he gave me? Because I don’t!

Why did he lie to me?" Fresh tears formed in Elizabeth’s eyes.

"I don’t either. He probably met someone else and wanted to let you down gently. He really cared about you Liz, but he’s right, sometimes it just doesn’t work out. In the end one thing’s always there to bail us out."

"What’s that?" Elizabeth said miserably.

Angela gave a smile, "Ice cream and chocolate. Yes I know that’s two but they are inseparable. What’d you say I walk into town and get some chocolate fudge cream? We’ll have a girls’ night in to celebrate surviving a whole three months with each other."

Elizabeth liked the idea of that. Angela had been her rock during her time here. She always seemed to know what would make her feel better and was always someone to sound out at. She hadn’t regretted telling Angela her secret at all and, in fact Angela knowing it had helped her start to come to terms with losing Nick. Not that she wasn’t still as mad as hell with him it’s just that Angela made you forget your anger for a while and that, Elizabeth decided, was just what she needed, "Ok make sure it’s the good stuff. This is a three tub situation. Oh yes, could you pick up my medicine again for us. I just don’t seem to be in the mood right now," Elizabeth managed a smile.

"Oh at least a three tub. I’ll buy four just in case. Your prescription’s in the usual place right?" Angela smiled, picked her purse up and walked out.

Elizabeth stretched her long legs out over the sofa and reclined to think. It had been a very long three months and in spite of the work, which she had found ridiculously easy; she had enjoyed it. The early couple of weeks had been freaky, the memories of the Children of Bexley rally were still fresh, as where the feelings related to that event. Part of her still felt elated at being worshipped like that. This feeling was dimmed by her anger at the baseless way they accused her parents of defrauding Dr Bexley.

She was pleased to be able to help Angela out with her studies.

It had repaid at least in part the help Angela had been to her. Angela was clever but really had to work hard to get the good grades she needed. In spite of her coaching Angela never seemed to be able to get to grips with ‘thinking in permutations’ but that too was fine with her. Elizabeth had missed her parents and even Auntie Cathline hadn’t visited since that first trip when she’d just moved in. She knew that this was a deliberate strategy by her parents but that didn’t matter. She knew they loved her and that they were’ doing what they felt was right for her. She was a little sad that Alex hadn’t been able to come. She missed their verbal sparring and the annoying way he called her ‘kiddo’. No doubt Alex would visit sometime over the vacation, and some old scores would be settled and some new ones created. She checked her watch fifteen minutes had just flown by. Her train of thought was broken by a sharp series of knocks at the door. Wearily she stood up and answered it.

"Hello Ms Stephens," A silky smooth voice said.

Elizabeth nearly jumped at the sight of James Adams. Leader of the Children of Bexley cult. He had dressed in a sharp Armani suit with impeccable tie and shirt. His hair was neatly trimmed and his eyes showed a look of friendly concern.

"Fuck off!" Elizabeth snarled.

"I came to apologize. Please let me come in. I promise no tricks, no worship, no anything, just apologies." James said in a comforting tone.

"Say what you have to say and then go. PDA Set instant alarm, usual parameters." Elizabeth called.

James heard Elizabeth’s PDA beep signaling that the police would be called the moment Elizabeth desired. That didn’t bother James. He hadn’t come here to make trouble.

"Thank you, " James said and pushed past Elizabeth and sat down on the sofa where Elizabeth had just been laying.

"Ok what do want?" Elizabeth said, folding her arms in defiance.

"I wanted to say I’m sorry about what happened at the meeting a few months back. It’s taken me a while to track you down but you must know all that worship stuff wasn’t my doing. Sure I feel as though Dr Bexley had a great deal to teach us but she was not God." James’s voice was soft and placating.

Elizabeth unfolded her arms but moved towards the door "It wasn’t the worship stuff that bothered me. It was the lies about mom and dad. I don’t hear you saying you’re sorry about them."

"Ms Stephens, Elizabeth. In our lives our judgement is clouded by our environment, who we are and what we do all affect the way we look at things. By all accounts you have a brilliant mind. Have you ever turned it to looking at the facts surrounding Dr Bexley and your dad’s involvement in her life?"

"I don’t need to. I’ve seen the evidence," Elizabeth snapped.

"Only the evidence that you yourself have chosen to believe. If you would take a fresh look thru the dispassionate eyes of science you would see a lot of the evidence you have been shown doesn’t hold water. What I’m about to show you is top secret. It’s been in my possession for a number of years but I want to show it you in order to make my point."

"You’re not going to convert ME! Elizabeth snapped.

"I’m not wanting to convert you. Just free your mind to other possibilities." James pulled out a plastic bag from his inside pocket, "What’s this?" he asked, showing it to Elizabeth.

"It’s a receipt dated 15^th July 1997," Elizabeth said.

"What’s it for?"

"Cosmetic alteration of a woman called Jane Andrews the sum total is fifty two thousand dollars," Elizabeth said suspiciously.

"Can you outline the work performed by the clinic. In lay terms please?" James asked.

"Breast, hip and face alteration. Body sculpting and fat re-distribution and hair transplants. In my opinion this Jane Andrews was given a whole new look from head to toe. She was remade as someone else," Elizabeth stated.

"Whose is the signature on the bottom of the receipt?" James asked. His voice a flat tone, like a lawyer in a court case.

"It’s a little hard to make out but it looks like dads," Elizabeth voice tailed off as the realization hit her.

"That’s right. Jane Andrews is your mother’s maiden name and the signature at the bottom of the receipt is your dad’s. On the 15^th of July 1997 he paid Jane fifty grand to become another woman. If you look at the specification of the work done it fits in exactly with Dr Elizabeth Bexley’s vital stats. Why would he do that if not to create some outlandish story about DNA altering?"

Elizabeth stared at the receipt," This, this is a lie. It’s a fake," She started to blink back tears.

James voice lowered to a comforting tone, "It’s no fake. I’ve had it analyzed by the MIT genetics lab. You can check with them if you like. The fingerprints and DNA fragments match that of your father. He did sign this, the work was performed and I’m afraid to say that we have all been lied to. All the time this whole Fury thing was a hoax. Why was there no trial in order to ascertain who should get Dr Bexley’s money after she vanished? Elizabeth, listen to me. Do your own research with an open mind and you’ll see that I’m right."

Elizabeth started to sob. It couldn’t be true. It was all a trick. It had to be. Her parents were not like that, they would never ever do anything like that. Make up a story, kill and discredit for money, never!

James put a comforting hand on Elizabeth’s "I know it’s hard and I know you don’t trust me I wouldn’t if I were in your place. All I want you to do your own reading and reach your own conclusions."

"Why’d you tell me this?" Elizabeth sniffed.

"Because I want you to know the truth. I know you’re not really a copy of your dad because DNA altering technology doesn’t exist."

Elizabeth gave James a defiant glare, as if to say ‘so prove it doesn’t!’

James ignored the glare and continued "Before she died Dr Elizabeth Bexley cloned you from her own DNA. That much is possible. There is no other explanation for how you look or how you are. You owe it to yourself and to your mother to find out the truth and let that truth be known. You are her legacy to us."

Elizabeth tried her hardest to subdue the look of shock she felt. THEY KNEW! How in hell could they know about her true origins? What were they going to do with that information? Did they want her to join them or at least acknowledge that they had some valid points to make? Indeed James did make some valid points and she would ask dad about that receipt when she got back. What if what she had been told was a lie? Where would that leave her? Did she have a greater loyalty to the truth or to her parents?

"I see that you knew you are Dr Elizabeth Bexley’s daughter already. Don’t worry, we’re not going to do anything that will harm you or the ones you love. You parents have portrayed us as the bad guys but they couldn’t be more wrong. Even though you may not believe us we do care about you Elizabeth, we really do. We don’t want to see you hurt or lied to. As Dr Bexley’s heir you are a precious jewel to us. Look, I’ve said enough I can see you are in turmoil over this. Please speak to your mom and dad. Ask the questions you know you want answers to. Use that exceptional brain of yours to find out what really went on twenty years ago," James voice had a soothing tone to it and Elizabeth began to feel a little better.

"I still don’t," Elizabeth started to say. Her mind was in turmoil.

Her whole life had been built around what had happened before. Her whole view of herself as a potential time bomb had been colored by these events, and now this man sitting in front of her was telling her otherwise.

James read what she was thinking "That’s right Elizabeth. You’ve spent all your life afraid of what you might become and now you’re starting to realize that you have nothing to be afraid of. Since you first knew who you were you’ve lived in fear, fear of what you might do if you trusted and fear of what you might do if you loved. That’s a terrible burden for anybody let alone someone like you. You needn’t feel that anymore. If you embrace the truth then it will set you free."

Maybe James was right. She had spent her whole life in fear and self-loathing. The burden had been a hard one. Elizabeth was so tempted to believe what James had to say. To be free of the specter of the ‘hell bitch’ was alluring. But the price she would have to pay would be too much, "I can’t betray my parents," Elizabeth said softly.

James shook his head, "I’m not asking you to. All I’m saying is believe that Dr Bexley wasn’t the monster the world made out. Are you a monster?"

"No, " Elizabeth almost whispered.

"I believe you. Why don’t you believe yourself? It’s because you’ve not sought the truth."

"What is the truth?" James’s faultless logic, comforting voice and wisdom had worn down Elizabeth initial resentment.

James looked Elizabeth in the eyes and said in a voice much like her fathers when he wanted to comfort her, "The truth is. Is that Dr Elizabeth Anne Bexley was not the monster the world has portrayed her as. She was compassionate, gentle and kind. I’ve spoken to those who knew her. They all say she was kind in spirit, funny and full of life. She committed suicide so that your Mom and dad could live in peace. She knew that no matter what she did the world would always remember her as a manipulating serial killer and that nothing she did to disprove it would matter. It was better she die than try and live disproving a lie that the whole world believed. Elizabeth you are so like her. I can see in you the potential she had but was forced to throw away. If you tell me to go and leave you alone I promise I will never return. I’ll leave you in peace but please, please look beyond what you have been told. Look into yourself. Could you ever kill anyone?"

Elizabeth’s shook her head, "No I couldn’t. I did a study on HER once. You are right, she was a lot like me. I think it’s time you left. I will do as you say, just for completeness. It’s best to look at both sides before reaching a decision. Can I have that receipt?"

"Sorry no. But here’s a copy. I’ve sent you the lab reports from MIT as well" James said, reaching into his pocket and handing Elizabeth a slip of paper.

At that moment Angela walked in holding a bag of shopping. She took one look at James and screamed, "Get the FUCK out of here!"

"It’s ok I was just leaving." James said, rising to his feet.

"Elizabeth what the fuck is HE doing here. What’s he been telling you?" Angela demanded.

"He came here to apologize," Elizabeth stated defiantly.

"I must be off. Thank you for your time Elizabeth, "James said and strode past Angela and out of the door.

Angela turned to face Elizabeth once more, "What exactly did he tell you?" She demanded.

"He came to apologize to me and then asked me to look at the evidence surrounding the fury with a scientific mind. Ignore what I’d been told and see for myself."

"And you told him to go shaft himself right?"

Elizabeth shook her head, "He made some valid points. I was as surprised as you are."

Elizabeth then outlined her conversation with James.

"I must admit that receipt, if it is valid is mighty suspicious. You’ll have to let me know what you find. I know we’ll work on it together," Angela said.

Elizabeth was relieved that Angela had offered to help. She would be her backup in case things went awry. She couldn’t get out her mind what James had just said. ‘That’s right Elizabeth. You’ve spent all your life afraid of what you might become and now you’re starting to realize that you have nothing to be afraid of. Since you first knew who you were you’ve lived in fear, fear of what you might do if you trusted and fear of what you might to if you loved. That’s a terrible burden for anybody let alone someone like you. You needn’t feel that anymore. If you embrace the truth it will set you free.’

Above all that’s all she wanted, to be free.

o—o—o—

Anne Baxter sat down on the sun lounger by her pool. She had treated herself to a few days ‘R and R’ after a hectic couple of weeks on board the "Esau". There had been some resentment at her replacing Dr Quenby on such short notice but she had soon earned the respect of the crew and researchers. The ‘Esau’ was an older design having diesel engines instead of the more efficient fuel cells. It also lacked re-breathers, which meant she had to spent more time in decompression and limit the amount of time she could spend underwater. None of this mattered to her now. Her idea had worked, the theory was sound and the data gave incontrovertible proof of it. Now all she needed was a way to scale it up several million fold without damaging the ecosystems she was trying to save.

She hadn’t shared her findings with anyone yet, knowing that if the idea were exposed early then the political and scientific backlash would be considerable. Her only choice was to go for industrial backing, which ironically was one of the very things that were causing the destruction of the worlds oceans. It would take years and millions of dollars to develop the process fully and safely but at end of it the result would be almost limitless raw materials. Within a hundred years the world would have an oceanic ecosystem that was back the way it was several hundred years ago.

Anne felt as though she deserved a few days off. Her tenure still had two months to go but she already knew exactly what she needed to do. The rest of the two months would be spent in writing up her findings and proposals so she could publish them when the time came. Of course the world would think them as Steve’s idea with her carrying on his work. She didn’t mind this one bit. It was her ocean she was protecting, not her reputation.

Thinking about Steve brought back memories of his funeral. As she had promised she had attended even though she knew nobody there. She had been asked to say a few words and so she had said the usual platitudes, which seemed to go down well with all the mourning relatives. As a mark of respect she had placed a single red rose in his grave and then slowly backed away. She had flown back the next day, after a stop over in New York to visit her own parent’s graves before returning to Tel Aviv.

She thought back to the results of the tests she had performed. The plankton had responded even better than she had imagined. Anne was feeling not a little smug and satisfied. It’s not everyday you develop something that could save millions. Anne decided to celebrate a little. It had been too long since she’d indulged herself. Far too long and what the hell!

"PDA get room service to order me another bottle of Champagne. The Bollinger 18 will do. Oh and play track 8 personal collection."

Anne put the ear piece to her ear sat back and listened to the instrumental music track. A big smile was all over her face. It was good to be back.

o—o—o—

Elizabeth stood on the bow of the boat watching the sunset over the Maldives. She never tired of the view, the infinite variations of red, orange and yellow reflected on a turquoise sea. Today’s sunset was a deep blood red with flecks of orange fire scattered at random throughout the sky. Elizabeth was extremely tried from the journey. A twelve hour flight from London to Male, followed by a four hour boat trip to her parent’s island. She had been too late to take a chopper over and hadn’t thought to charter one in advance. Actually she preferred the boat trip. It gave her time to clear her mind and to reflect upon what she wanted to ask and what she wanted to do.

The conversation with James, the cult leader had disturbed her more than she had first thought. Coming so soon after her breakup with Nick it had left her feeling as though she had been stretched in all directions at once. She had read the notes the cult leader had given her on the way over and had to admit they did make a certain degree of sense. She resolved to make it her business to find out but first she would unwind. She knew from her parents Email that Cathline and Alex would be there too. It would be the perfect forum in which to mount her investigations. She was still worried about what she would do with the information she uncovered if it showed what James had told it would. Would or even could she disclose her findings? No she decided she wouldn’t. This was to be for her benefit only.

Elizabeth wished Angela were here. She had so wanted to share with her the world in which she lived. Sure the island had pools, gyms, tennis courts and everything that an exotic resort needed but to her it was just ‘home’. She checked her watch there was still over an hour to go. Elizabeth fished out her new PDA. She had spent the remainder of her allowance on upgrading it to the latest Sony-Micro-Sun model. Its shiny silver metallic case glinted in the sunlight. She thought Nick would like it, but then remembered that Nick was no longer part of her life.

This brought another twinge of sadness as she remembered the fun Nick and her had had. Still clutching her PDA she walked to a nearby chair and sat down.

"PDA open up a video channel with mom and dad," she said.

The PDA bleeped a few times and eventually Kat’s face appeared on the small plasma screen. On seeing Elizabeth her face broke into a wide smile.

"Hi Mom. I’m on the boat coming over. I’ve got about an hour before they drop me off,"

"Elizabeth! It’s great to see you. We’ve missed you so much. Hey, I didn’t know they had a vid-phone on that ramshackle thing," Kat.

"Dad’ll love this. It’s my new PDA. It’s got a built in satellite vid- phone. It is shall we say well cool. Has Cathline and Alex arrived yet?"

Kat’s face nodded, "They arrived last night. It’s so nice to have every one back together again. I’ve sent the servants away for the holiday so it’s just us for a change. I’d better go this must be costing you a fortune."

"Bye mom. See you in an hour or so," Elizabeth gave Kat a smile and ended the call. How could anyone remotely think that her mom was involved in grand theft and murder? No way!

Elizabeth decided that she needed to take her mind off things a little. Things were getting a little too stressed in her life at the moment. Pressure had been building up inside her since she’d first got to Cambridge and she had hoped that her few weeks at home would enable her to relax a little. Her little conversation with James had ruined that idea. She considered the option that his visit was timed in order to achieve this. But what did he have to gain by ruining her vacation?

Not a lot Elizabeth had decided. He was definitely up to something, that much was certain but what? He did make a few very good points. Dr Bexley was not the monster she was portrayed as. She had come thru in the end to resolve one of the twentieth century’s closet calls with war. She really did have nothing to fear from her. Being like her should be a source of pride not of shame. James had been right in that much anyway.

Too much fear, loathing and distrust had been heaped on Dr Elizabeth Bexley and Elizabeth decided that she was guilty of that as well. The best way for her to find out what really happened all those years ago would be to try and get inside the mind of Dr Bexley. It was something only she could do and maybe that’s what James was after in her. Somebody who could get inside the way she thought and operated in order to ascertain the facts. Until her investigations were over she would have to act, think and behave like Dr Bexley. No other way would give her the insight into whether she could have done what she was supposed to have done. It would be a simulation, where she could play out scenario’s in her mind do see if they fitted in with what she knew. A role play with a serious purpose in mind, to once and for all silence the critics.

It could not be a true simulation as she still took her Olanzapine and hadn’t had the trauma of being jilted like Dr Bexley had. Did that matter?

Well yes it did. The whole jilting event had led to events in the supposed fury and without that trauma it was very likely that Dr Bexley would have gone on to lead a normal life. In order to perform the simulation properly she would have to stop taking her Olanzapine and generate a traumatic event. The hurt and pain of being dumped by Nick was still very much there. Would that be enough?

This idea worried Elizabeth. She could see herself getting sucked into Dr Bexley’s thought patterns and not getting out again. She needed another safety net, somebody who knew her well enough to know when she was over stepping the mark. Her parents and Cathline wouldn’t do. They would have a hissy fit if they found out. Angela was too far away and Elizabeth expected that she’d have the simulation run by the time she returned to Cambridge. That only left Alex. Alex was the perfect choice, he would know when she was taking it too far and in spite of his annoying big brother act he could be trusted. Yes, that would work. Alex would be her safety net.

Elizabeth put all thoughts of the task in hand and set about finishing the configuration of her new PDA. The interface was still as standard—she liked to be able view multiple panes of information at the same time. It took far too long to look at things one at a time. She pressed a small depression in the side of the PDA and extracted the small pencil sized wand. This was by far the quickest way to draw out exactly how she wanted things to be. She did wonder what Dr Bexley would have thought of it. No, she told herself; from the time she stopped taking the Olanzapine and setting things up with Alex she WAS Dr Bexley. Nothing else would work. With that in mind she drew eight small boxes on the screen of the PDA. Each one would act as a separate or virtual PDA and have all the functionality of the main one. Her interface configuration completed it was now time to test it. It had been a while since she had used her brain to it’s full capacity, now it was work out time.

"VPDA1 search and display all personality profile and biographical data on Dr Elizabeth Anne Bexley. Born 1969, died 2001," the top right screen issued a "searching" message.

Elizabeth had already set in her mind the information she required.

"VPDA2 search and display all evidence pertaining to the creation of the so called DNA altering compound created by TGen corp in 1997. Also give complete details on the activities of TGen corp during Dr Elizabeth Bexley’s tenure there.

"VPDA3 search and display all testimonies and evidence both written and aud-vid given in the two Bexley trials.

"VPDA4 search and display personality profiles and biographies of Matthew and Jane Stephens. Cathline and John, Richards, Robert Abbey, Robin Abbey, Vickie Turner, Stephanie Lane, Salah, Detective Scott Harris NYPD, Detective Tina Cox NYPD and Senator Walter Jameson.

"VPDA5 search and display all guild records pertaining to the provision and use of genetic weapons. Include Guild records on Tel-Aviv."

VPDA6 search and display all UN, governmental and international records on the state of DNA research from the years 1991 to 1997. Include theoretical information as well.

VPDA7 search and display all known information on the cult known as ‘The Children Of Bexley’

VPDA8 "Cross reference information from VPDA’s 1 thru 7 and display commonalties and inconsistencies. Also give suggested conclusions to inconsistencies. Zoom out to max pane size when complete."

Elizabeth completed giving her PDA instructions. The poor thing would be working flat out for the few hours. She was sure that people had done similar searches at one time or another but she had an advantage she had access to the raw data. She closed her eyes and in her minds eye started to form a model of the connections she knew were valid. Possibilities and permutations danced in front of her as she mentally linked them together. The output of these links she formed into new connections until it formed a three dimensional model in her mind. She knew this wasn’t the real thing, she still had incomplete information but it would suffice as a rough draft. She didn’t expect to complete the model first time off; that would take several days as Dr Bexley. But when it was complete she would know her late mother better than anyone ever did and furthermore be able to put to rest any doubts she had about her parent’s motives and methods. Another byproduct would be that it would finally end her fears and enable her to be more open and trusting. In short it was the only way she could see that she could grow as a person. She concentrated a little more and in her mind the model span into greater clarity Elizabeth was so wrapped up in her thoughts that she hardly noticed the boat dock at her parent’s Jetty. It wasn’t until she felt the slight bump as the boat drew up alongside that she mentally filed away her simulation and open her eyes. Naturally all the family was at the quayside. Matthew holding Kat’s hand, her brother John standing alongside him. Cathline and Alex were there too waiting for her to come ashore. On seeing them she gave a smile and a vigorous wave and went down below to collect her cases.

A few minutes later Kat was embracing her and she felt a sigh of relief, she was home.

o—o—o—

Kat had made Elizabeth’s favorite for dinner, Cajun Chicken salad and as usual it was more than up to standard. Elizabeth was ravenous after the trip and ate without speaking a word. Elizabeth decided she missed home cooking, especially Cajun Chicken salad.

"It’s nice to have everyone back together again," Matthew commented.

"Hey Kiddo. I’m sorry I didn’t get to see you more, but I had other things to do, " Alex said.

Elizabeth was surprised, no insult from Alex. This was a first. "That’s Ok I missed you too. What do you actually do for a living Alex?" she jibed.

Alex gave a grin, "That’s for me to know and you to find out."

"Cathline, oh before I forget we had a tidy up of all HER and our old stuff. You want any of it before we burn it?" Kat asked.

Elizabeth nearly choked on her chicken. She needed that stuff. Was there anything she could say that would allow her to have it without arousing the ‘why do you want it?’ question. She decided to wait until Cathline answered.

"I dunno Kat. It’d take me months to go thru it. I think I’ve said everything that needs to be said," Cathline replied thoughtfully.

"I’ll help you," Elizabeth blurted. Actually this was more like a considered response. She had toned it in precisely the right way to give the ‘I want to help but I don’t really mind either way’ inflection.

Cathline considered Elizabeth’s request "Ok Liz, you can have first look. Let me know if you find anything of interest. See if you can find anything of note in HER old journals. She kept everything, even her blank notebooks, clothes the lot. She was nothing if not thorough,"

Elizabeth’s heart leapt. ‘yes’. "Thanks Cathline. I would be able to spend a lot of time on it but I’ll have a go."

o—o—o—

Elizabeth awoke the next morning and out of force of habit reached over to take her Olanzapine. She had the glass of water in her hand ready to swallow the small white pill in her mouth when she remembered that she wasn’t going to take it anymore until her research was completed. In order to allay any suspicion she placed the glass of water on the bedside table and crushed the pill to a powder. She then drank a small amount of the water in order to make her mom think she’d taken it. How would she feel after the cumulative effects of the Olanzapine wore off? Would she suffer any kind of withdrawal symptoms? Her reading had indicated not but everyone’s physiology was different. Would she be able to perform those amazing leaps of logic and intelligence that Dr Bexley had been able to do? From her previous research on the fury, not taking Stelazine had allowed Dr Bexley to produce some stunning discoveries. The closer Dr Bexley came to insanity the more devious, intelligent and vicious she became. Elizabeth hoped that she could control those tendencies, and if she couldn’t there was always Alex to bail her out.

By now her PDA should have produced all the results from her searches, so she pulled open the drawer in the bedside table, retrieved her PDA and sat down to read. As she had ordered VPDA 8 had maximized its display pane and had a list of inconstancies based on all her other searches.

1. The energy required to perform any kind of DNA transformation would result in an extreme exothermic reaction. The subject would literally burn up. Conclusion, DNA modification as suggested by the late Dr Elizabeth Anne Bexley is virtually impossible with current techniques.

2. If the subject’s brain were left intact there is a strong possibility of tissue rejection thus causing an almost certain fatal reaction within the subject’s body. Conclusion, DNA modification as suggested by the late Dr Elizabeth Anne Bexley is virtually impossible with current techniques.

3. Every other paper postulating on DNA modification stated that modification of the genetic code was impossible once cell multiplication had occurred. Conclusion DNA modification as suggested by the late Dr Elizabeth Anne Bexley goes against all current thinking and current techniques.

4. Cosmetic alteration could provide an identical copy of a person so long as the right subject is chosen. Conclusion, total body remolding is only possible by using surgical methods.

5. DNA testing as performed in the late 1990’s was not infallible. Conclusion, DNA testing is not a foolproof method of determining identity.

6. No full copy of the human Genome was published until 2001. Conclusion, TGEN had only produced a working draft when they announced completion of the human genome project. The draft was not enough to be able to control human DNA to the extent proposed.

7. No analysis of the agent used on Tel-Aviv is available. However significant damage to metallic structures was reported in some areas. Fire damage made complete analysis difficult at the time. Conclusion, Inconclusive information on the agent used on Tel-Aviv. Possibility of genetic warhead use is postulated to be less than thirty percent.

8. Records pertaining to the ‘fury’ are based on personal recollection and events. No testimony from Dr Elizabeth Anne Bexley was ever obtained. Conclusion, in order to fully verify findings more information is required.

9. Even allowing for psychotic behavior, Dr Elizabeth Bexley’s personality profile prior to the fury does not match that of the actions attributed to her. Conclusion, the actions attributed to Dr Elizabeth Bexley were carried out by person/s unknown. However, there is a small possibility of extreme personality disorder in Dr Elizabeth Bexley. Probability of former conclusion, greater than eighty percent.

10. Governmental and UN restrictions on data pertaining to genetic modification are classified. No further analysis is possible.’

11. Records pertaining to persons mentioned in VPDA4 are classified. No information available.

Elizabeth skipped to the bottom of the pane.

‘Overall Conclusions

Probability of DNA Modification 2%

Probability of DNA Warhead use on Tel-Aviv 30%

Probability of accurate testimony 40%

Probability of Dr Elizabeth Anne Bexleyinitiating the events in fury 20%’

Elizabeth gave a low whistle. The numbers didn’t look good. However the PDA’s probability figures were based on processed information. They were only as good the information it had found and been given. She would need to start her simulation soon. She changed her mind about telling Alex of her plan. If he said something to her about her behavior then she would know something was up. Telling him would only bias his opinion. She refused to believe the PDA figures. No way could they be that low could they?

Elizabeth swung her long legs out of the bed and looked out of the window. The sun had just finished rising and the heat of the day was starting to rise. Elizabeth took off her nightdress and stepped into her shower. Soon warm soapy water was cascading over her body and Elizabeth felt herself relax.

After this quick wake up shower Elizabeth changed into her shark skin bikini and went for her now traditional morning swim. Dr Bexley had been fastidious to the point of obsession about her fitness and reportedly spent many hours a day either in the pool or in the gym. Elizabeth decided that she would gradually work up to the same routine. She found pushing her body to it’s limits helped clear her thoughts.

An hour or so later Alex found her, still doing lengths in the Olympic sized pool. "You still at it?" he commented.

Not wishing to break up her routine Elizabeth ignored him. If he wanted to talk to her he’d have to jog alongside.

"Be like that then. I only came to see if you were ok," Alex said grumpily.

Performing a flawless turn Elizabeth set off towards the other end of the pool. Should she start work now or wait until tomorrow when she was sure the effects of the Olanzapine had worn off? She could wait but then there was still a lot of sorting to be done and that didn’t need her in ‘Bexley mode.’ Alex had caught her up and was saying "Are you OK? You’re pushing yourself too hard?"

"I’m ok. I’m out of shape," Elizabeth managed to say before submerging for a prolonged underwater period. She would try and swim the whole length underwater.

"Ok you just seem to be more serious than you used to be. Oh well I’m off to watch Matthew and Kat race each other round the island," Alex mentioned, and walked off.

You’d be serious if you didn’t know who you were, if your parents had been keeping something from you and whether your real mom was the monster people thought she was, she thought to herself.

Elizabeth swam for a further hour until she felt as though she couldn’t swim another stroke. Dr Bexley was WAY fitter than she was. Did that matter? Probably not, as Dr Bexley said she needed all her strength to cope with the demands of changing her body. Still it gave an indication of how far she still had to go. After drying herself off she made herself a quick bowl of museli and ate it ravenously before making her way into one of the spare rooms.

Matthew and Kat was right, they had cleared it up. Before she left this room was piled high with twenty years worth of rubbish. Now it was all in neat piles with yellow ‘stickit’ notes on each pile. The room had a major division with Matthew and Kat stuff on one side and Dr Bexley’s on the other. Naturally she headed straight towards Dr Bexley’s pile.

One thing caught her attention. A large mahogany chest with EAB engraved on the lid. Elizabeth raised an eyebrow, real Mahogany. The chest alone would be worth thousands now. She sprang it open to reveal clothes all neatly folded into types.

She picked up a short, reddish blue skirt. It was way out of fashion now but was still passable as clothing. Elizabeth was a little overawed ‘SHE wore this. My real mother wore this’ she thought. ‘What were you thinking and doing when you last wore this?’ Elizabeth tried to imagine Dr Bexley wearing it. She took a quick look around and checking no one was looking slipped the skirt over her already dry bikini briefs. ‘Of course it fits’ she thought. Already she felt a connection with her late mother, ‘strange how a simple object can evoke so much feeling.’

Elizabeth rummaged around in the chest until she found a matching white blouse. ‘Would SHE have matched this with this?’ Elizabeth wondered. Once again checking that the coast was clear Elizabeth put the blouse on over her Bikini top. Some more rummaging revealed matching shoes, a bra and some pantyhose. Elizabeth drew the curtains and got dressed properly, putting on Dr Bexley’s old bra, skirt, blouse, pantyhose, panties and shoes. She dug around a little bit further and found a shiny plastic disk in a transparent plastic case. ‘Hmm this is a CD. How am I going to play this?" Elizabeth thought. She turned the case over and saw a series of song titles handwritten on the back of the jewel case.

Elizabeth sought out a mirror in the room but found none within easy reach. She felt excited as though she was embarking on something forbidden, dangerous and downright stupid. She quickly ran from the room back to her bedroom, slammed the door shut and stood in front of the mirror.

The likeness to the pictures of Dr Bexley was uncanny. Sure her hair was shorter but her face, how the clothes looked on her and everything was identical. That fact didn’t bother Elizabeth—of course she would look the same. What did bother her was how her face looked in the mirror. It had lost the soft fun loving lines of the girl who’d left here a few months back, and now the eyes looking back at her had a sad, haunted look about them. Her face too had got harder looking, as Angela had told her. She had lost the look of innocence about her. Strangely this didn’t bother her as much as she thought it would, as Kat had said she needed to grow up and find her own place.

Elizabeth posed a few times in front of the mirror. Dr Bexley’s clothes did really suit her. Maybe it was the clothes that made her look a little harder. The pain of losing Nick still riled her—at least he could’ve told her the truth. She’d read that Dr Bexley had often listened to music while she worked. Elizabeth walked to where she’d placed the CD and chose the first track on the case.

"Hi-Fi, download and play ‘The Queen Of Hollywood’ by the Corrs’," her stereo beeped a confirmation and started to play

"She drove a long way through the night

From an urban neighborhood

She left her mother in a fight

For a dream misunderstood

And her friends they talk on corners

They could never comprehend

But there was always something different

In the way she held a stare

And the pictures that she painted

Were of glamour and of flair

And her boyfriend though he loved her

Knew he couldn’t quite fulfill

He could never meet her there

She’s never gonna be like the one before

She read it in her stars that there’s something more

No matter what it takes no matter how she breaks

She’ll be the Queen of Hollywood

And the cynics they will wonder

What’s the difference with this dream

And the dreams of countless others

All believing in TV

They see their hand prints in a sidewalk

Flashing cameras on the scene

And a shining limousine

She’s never gonna be like the one before

She read it in her stars that there’s something more

No matter what it takes no matter how she breaks

She’ll be the Queen of Hollywood

She’s believing in a dream

It’s a loaded fantasy

Now her mother collects cut-outs

And the pictures make her smile

But if she saw behind the curtains

It could only make her cry

She’s got hand prints on her body

Sad moonbeams in her eyes

not so innocent a child."

"Hi-Fi, stop play," Elizabeth said. This was getting scary. The song outlined exactly what she felt. She had lived with the ‘Hollywood’ lifestyle all her life. Lived with being the appropriate term. There were few occasions when she could have honestly said that she had enjoyed it. In fact, in spite of Nick her time at Cambridge had been one of the happiest of her life. Break time was over. It was time to see what else was in the junk room.

o—o—o—

Cathline had just walked back from the jetty, leaving a still squabbling Matthew and Kat there. The Jetski race had been bitterly fought and much to Matthew’s chagrin Kat had triumphed in all six races. She wasn’t unduly worried about them arguing. It was all very good natured, but those two did seem to take it especially seriously. She had made her way back to the house to get some more water. Apparently it was her turn to race Matthew next—she would of course let him win as his ego had been bruised enough. John and Alex had taken the yacht back to Male to get some fresh supplies so they would be gone several hours. Cathline opened the door of the house and walked into the marble floored hallway. In the corner of her eye she detected movement from one of the upstairs walkways. A figure in a white blouse, reddish blue skirt and auburn hair had just shot into a spare room.

‘I wonder what Elizabeth is up to?’ Cathline thought. She hadn’t ever recalled seeing Elizabeth wearing such clothes. Normally Elizabeth was very fashion conscious and from what she’d just glimpsed her clothes were at least twenty years out of date. Cathline walked up the stairs and pushed open the spare room door. For a moment Cathline mistook the woman who had just whirled guiltily around for someone else, someone from her painful past. The moment after she realized who it really was, "Elizabeth what in hell are you doing skulking around like that? Whose clothes are they?"

"Hi Auntie Cathline. I’m just sorting thru some of Dr Bexley’s old things." Elizabeth pointed to her new attire, "I guess I got a bit carried away." Elizabeth’s face had instantly gone into the ‘innocent as a summers day’ look that she’d developed over many years.

"I’ll say you did. Why are you wearing her clothes? They don’t suit you at all," Cathline commented.

"I was trying to get inside her mind. To try and work a few things out for myself. If I’m to make any sense of all this." Elizabeth gestured to the contents of the room. "Then I need to go beyond just rummaging around at random. In understanding her I start to understand myself. Cathline, when I was away at Cambridge I discovered something horrible."

Cathline sat down on the floor, brushed her hair away from her face, and said ,"Which is?"

"That unless I break free of my fear of Dr Bexley then I’ll never be able to love or trust anyone properly. I don’t want that. Maybe I’m making too much of it but that comes from what supposedly went on all those years ago and what effect it had on the three of you."

Cathline picked up on the key word in that sentence, "Supposedly?"

"I have to keep an open mind on all things if my analysis is to be accurate," Elizabeth refused to be drawn any further. Revealing her plans to Cathline was the last thing she wanted to do. From now on Cathline, Kat, and Matthew were the ‘enemy’. The switch in status was a logical one. She couldn’t get inside the mind of her late mother unless she thought exactly like her, had the same prejudices as she did and viewed the world thru her eyes.

"I see. Is that why you wanted to look thru all her stuff?" Cathline asked.

Elizabeth nodded. "I need to free myself of HER. This is the only way’"

Cathline stood up and gave a brief nod. "Be careful. If you want to wear her stuff then fine but the second we detect that you’re acting strangely this little experiment of yours is to stop, right?"

"Thanks Auntie Cathline," Elizabeth breathed a sigh of relief.

Cathline almost bolted out of the door. She ran almost full pelt towards the beach where Matthew and Kat were still in full flow.

"Cheated? How can I cheat when we swapped Jetskis twice?" Kat was saying.

"You two, "Cathline panted.

"What?" Kat turned to face Cathline.

"It’s started, "Cathline said solemnly.

"What has?" Matthew asked.

"I caught Elizabeth going thru Dr Bexley’s old stuff,"

"So, she said she wanted to help," Matthew stated. "What’s the problem?"

"She was dressed in some of Dr Bexley’s old clothes. Actually it was the outfit she wore when she first came to my house, but anyway she gave me some spiel about needing to find out more about HER so that she could find herself. She said she needed to get inside HER mind in order to free herself, " Cathline’s voice had dropped to almost a whisper.

"What do we do? If we ban her she’ll only go and do it anyway when she’s back in Cambridge. If we leave her alone then we run the risk of losing her all together." Matthew now saw the seriousness of the situation.

Kat thought for a few moments. Matthew had a point. "We let her go thru with it but keep a close eye on her. If we push her away now we might never get her back. At least this way we can keep it quiet."

"At what point do we inform the authorities? When she starts turning people into goo? When she builds her late mom’s DNA system again? Or when she murders a boyfriend that decides to finish with her?" Cathline snapped.

"That’s an overreaction, Cathline. There’s no need for her to undergo the test just yet. She’s growing up, she wants to know who she is and where she came from. That’s a long way from killing people," Kat answered back.

"I’m with Kat on this one. This is our daughter for Christsakes. I was never happy about the arrangement as it was but it was the only way to let her live. Now are we going to send our daughter to something that could easily end up with her being committed for life just because she decides to play at being ‘hell bitch’ for a few days. Cathline, I know your role is to ensure that we stay on track, as the counterbalance, but this is too soon." Matthew’s eyes showed a glint of tear. It couldn’t be happening, could it?

"That’s unfair Matthew. You know I love her like she was my own. But we have a higher duty to ensure the innocent are protected. You’re right, it is too soon. I wish I’d never said what I’d said. It seemed so heartless and cruel. The whole deal is heartless and cruel. Let’s just keep an eye on her and leave it at that."

"Thanks Cathline. I hated the arrangement too. This business of ‘Should Elizabeth Stephens exhibit the same psychotic behavior as Dr Elizabeth Bexley then she is to be screened and tested for sociopath behavior. If the tests prove positive then she is to be committed to preserve the lives of those she would come in contact with.’" Kat’s eyes were glistening with tears now. The thought of her beloved daughter shut away in some institution was almost too much to bear. This threat had hung over their head for the past twenty years and now in spite of everything they had done it looked to be happening.

o—o—o—

Elizabeth breathed a sigh of relief. At least Cathline hadn’t blown her top at her. She was under no illusions that her excuse had done anything but muddy the waters a little. Cathline and her parents were too smart not to know she was up to something. However, there was no way that they could know what that something was. Elizabeth considered the options for a few moments. She could put the whole thing off until she got back to Cambridge, but then she would lose access to all Dr Bexley’s effects. Proceeding as planned would create too much suspicion, so there had to be some middle ground. In an instant it came to her, she would act as normal but gradually get into her Dr Bexley persona over a period of days. That way her parents would get used to her wearing her clothes for example and not get too worried.

After all, what had they to worry about? She wasn’t about to go killing people and whatever. This was a simple simulation, a thought experiment. Elizabeth realized that she needed a way to easily switch in and out of her Dr Bexley ‘mode’. So that in her mind she could flip between them and still preserve the integrity of both. She decided that giving her Dr Bexley mode a different name to herself would be the ideal way. She of course being herself would still be Elizabeth, that much was obvious, but what name could she give to the simulation?

She considered Lizzy, as that was suitably short and concise, but somehow it didn’t seem to fit. In order to name her Dr Bexley mode properly she would need to choose a name that Dr Bexley had used. Elizabeth considered Nemesis, but she had no reason to revenge anyone, except maybe Nick. Hera was another one she had used but Elizabeth had no control over all living things. Elizabeth cast her mind back—what was Dr Bexley’s first and last alias? That was it, Deianeria! That was the perfect name for her new simulated persona. From now on when she was being Dr Bexley she would refer to herself as Deianeria, and when—as she would be most of the time—she was being herself she would still be Elizabeth.

Elizabeth wondered if this dual name thing could be regarded as a mild form of multiple personality disorder, but dismissed the idea. Deianeria wasn’t a separate person, she was simply the name of a simulation; in just the same way someone names a ship or aircraft. Elizabeth formulated the rest of her plan. She would be Deianeria for the rest of the day but would continue to wear the same clothes. It would take that long for the Olanzapine to wear off anyway. Tomorrow after her swim she would take some new clothes from the chest, and again Deianeria would have to stay dormant. As the week progressed she would become Deianeria for small amounts of time, and thus not alert her parents and Cathline to what was really going on.

Elizabeth stood up, straightened her skirt, and after taking a last look around for today stepped out of the room. In the distance she heard Chopin being played from one of the side rooms. Alex was practicing again. Elizabeth had to admit that Alex was pretty good. Actually, Elizabeth thought Alex was good at a lot of things. It was interesting to compare their relative strengths. Whereas she was tidy, meticulous both in thought and deed, Alex seemed to live his life as he went along. Maybe that’s why they needled each other so much. They were opposites pure and simple. Elizabeth wasn’t that interested in art or literature, preferring the black and white, true or false that her meticulous mind easily grasped to Alex’s ‘go with the flow’ artistic flair.

She decided to go downstairs and see what Alex was up to—she felt up to some verbal sparring. It was something she liked about him. But she couldn’t help think that she was getting a little tired of this constant oneupmanship between the two of them.

Alex paused playing as Elizabeth walked into the room, "Hi Kiddo. That’s not quite your look is it?"

Elizabeth looked down at her new outfit, "Oh, what? This? Thought I’d play at being Dr Bexley for a while." How would Alex react? Would he take this as a hint as to her intentions?

"Whatever, " Alex said, ignoring Elizabeth’s comment.

"You’ve got better since I was last here, " Elizabeth commented

Alex pretended to fall off the Piano stool in shock, "You. You just gave me a compliment! Where’s my PDA! I need to note this down"

"I said better, not good, "Elizabeth said with a smile. This was more like it.

"Ok then, Miss Priss, you try, " Alex challenged. He knew full well that Elizabeth wasn’t anywhere near as musical as he was. In fact his whole ploy depended on it.

Much to Alex’s surprise Elizabeth agreed, "Ok, fine. I’ll do you a deal. You do my gene sequencing for me as well as I play the piano, and I’ll buy you dinner."

‘She took the bait’ Alex thought and held his hand out in order to sign the deal, "And if you lose?"

Elizabeth had a thought, "Then you have go on a date with

Angela when you’re next in Cambridge"

"Angela’s cute but not as much as you are," Alex said with a smile.

Elizabeth was a little puzzled. Was Alex making a move on her, ridiculous! "Yes but she’s available, I’m not!"

Alex looked around, "I don’t see any boyfriends here."

"I didn’t say I had a boyfriend," Elizabeth snapped. The subject of boyfriends brought the pain of Nick’s betrayal to the fore.

"Girlfriend? Now that’d be a scoop, " Alex raised an eyebrow.

Elizabeth gave Alex an ‘as if’ glare "Look, in the unlikely event I lose I’ll take you out—you lose you go out with Angela."

Alex reached out to shake her hand. "One more thing?"

"And that is?" Elizabeth demanded

"You take me out in Male! You’ll double cross me or something if I wait."

"Fine! Now where’s that spare stool?" Elizabeth said, and shook on the deal.

A few minutes later Alex was laughing his head off. "Liz, you play like a toddler who thinks a piano is a trampoline. Look, follow my fingers."

Elizabeth was in a huff. She hated being laughed at. "Look, just give me time. I can do anything I put my mind to."

Alex was still smiling. It was working out just the way he wanted it to. Elizabeth could do with some humility. "That wasn’t the deal, was it? How much time do you want Kiddo? You’ve either got it or you haven’t. And Kiddo you ain’t even close."

"Hmmph!" Elizabeth hated being shown up, especially in front of Alex. Why had she gone along with this stupid bet?

Alex stood up behind Elizabeth and took hold of her hands. He started to show her the finger movements in the correct pattern.

"It’s ok I can do it now, " Elizabeth stated. She had memorized the finger movements of this particular piece and was now confident she could play it.

"Ok go then, " Alex said.

"Don’t worry I will," Elizabeth stated. She was sure she had the finger movements memorized.

"One more thing? Let’s change to some Rackmaninoff," Alex said with a grin and flipped the page over.

"Hey," Elizabeth protested.

"I never said you had to play the same piece did I?" Alex said, his eyes alight with mischief.

Elizabeth gave him one of those looks that normally would wilt the most stern of hearts. Alex however had endured years of them and it now had the opposite effect.

Now Elizabeth was really cross. Nothing she did or said seemed to faze Alex in the slightest. She never seemed to come out on top of these tussles, and she could never work out why. "That’s enough! My turn now. You only have one chance at this. Remember, if I win you go out with Angela next semester. You have the following sequences available. Which is incorrect? CCTGAATAAGAGCAGAGCAAATTCCCTAAAGGGAA and CCTGAATAAGAGCAGAGCACATTCCCTAAAGTGAA." There, that’ll teach him!

"Umm, What was that again?" Alex floundered.

Elizabeth gave Alex and evil looking grin. "You also have to tell me why."

Alex furrowed his brow. Knowing Elizabeth, it wouldn’t be easy. It would be a trick question. But then again she would know he knew that. Oh well, dinner with Angela wouldn’t be that bad.

Alex took a wild guess, "Both of them. You made them up"

Elizabeth shot Alex a look! "I’ll meet you at eight," and stomped out. She was now well and truly pissed off at this constant one up man ship even though she had participated in it.

Alex wore a grin a mile wide. It had worked out perfectly.

o—o—o—

Elizabeth thought about dressing up as dowdy as she could for her dinner with Alex. Her parents and Cathline had reacted with typical amusement at the result of the bet, so they were no help at all. The only help her dad had given her was to charter a helicopter to fly them over to Male. It seemed as though Alex had planned the whole deal out. They would fly to Male, and get a boat to Rangali before dining at the Hilton resort hotel. Elizabeth really wanted to go in her jeans and T-Shirt but then she would look the fool, not Alex. Then she had another idea. She would go and see what Dr Bexley had in the way of evening wear.

As nonchalantly as she could muster Elizabeth walked into the spare room and started to search thru Dr Bexley’s clothes. Like herself, Dr Bexley liked to dress well, and surprisingly she liked a lot of what she saw. There was no need to involve Deianeria in the decision. After much searching she found an exquisite black dress. It was strapless in design, and showed more flesh than Elizabeth normally wanted, as the entire back was exposed as well as almost all of the right leg, and it also had a plunging neckline. Quickly stripping off her existing clothes, she put the dress on, noting with satisfaction that it went in and out in all the right places. It still needed a little something, something that would guarantee she’d get all the attention and not Alex. That was it! Garter belt. The cut of the dress meant that when she walked she would expose the tops of her garters as well as the straps. It would give her a ‘slut’ look, and normally she’d shy away from such a look, but this wasn’t a date, this was war!

Elizabeth couldn’t find any of Dr Bexley’s garters, so she scurried back into her room and quickly put her own on. As expected, she knew the effect her look would have on every male in the room would be devastating. She knew Deianeria would be pleased too, the perfect predator. She fished up her makeup kit and proceeded to use it, not too much but enough to bring out her high cheek bones and blue-gray eyes.

At seven fifty there was a knock on the door. Elizabeth opened it expecting to see Alex but was surprised to see Bob, the local chopper pilot. Her surprise turned to sadistic pleasure when she saw his eyes widen and he tried his hardest not to eye up his customer.

"Alex will meet us in Male," he managed to mumble.

"Ok let’s go," Elizabeth said and followed Bob downstairs.

Matthew was sitting in the library when he saw Elizabeth waft past. "My god, " he whispered to himself. Elizabeth had somehow transformed herself into the very image of Dr Bexley the night she’d proposed to him. It was an unnerving sight, as if a ghost had just walked past. Matthew decided to say nothing. Elizabeth had been acting perfectly normal all day and had even fallen for Alex’s little bet. Apart from dressing up there was nothing to be concerned about. Matthew went back to his reading. Alex sure was a lucky guy.

Elizabeth landed about an hour later. The chopper flight had been short and boring. She had sat in the seats at the rear and so didn’t have the pleasure of seeing Bob distracted from his job. A cab was waiting for her as she stepped out of the chopper. "It’s ok miss, Mr Richards will be waiting for you by the quayside."

Elizabeth gave a nod. Alex had certainly planned this all out. Ten minutes later Elizabeth saw Alex leaning against a street lamp. On hearing the cab draw up he gave a wide grin and moved to open Elizabeth’s door. Elizabeth was about to complain but decided that if Alex wanted to be the gentleman then she would let him. It would make a nice change from playing the clown.

"Why thank you, " Elizabeth said as Alex opened the door. She noted with immense satisfaction that Alex’s eyes were wide open and that he had cast an appreciative glance up her exposed leg. Now the hunter becomes the prey, Elizabeth thought.

Elizabeth suddenly noticed that Alex was dressed in his casual clothes "You’re a little underdressed aren’t you?"

"Not for what I have in mind. I knew you’d try and out do me and you did. You look absolutely stunning. I don’t think I’ve ever seen you look so good but for what I have planned you’ll have to change."

Elizabeth took the compliment in her stride, she knew she looked good. However she did see herself as being out maneuvered yet again by Alex. Why didn’t she think to ask what she should wear! "This is all I have on," She complained.

Alex pointed to a small bag on the floor. I knew you’d do something like this. That’s why I brought you a change of clothes. I’d hate for you to ruin that outfit."

Elizabeth snatched the bag off the floor and looked around for a place in which to change. She spotted a small cafe a hundred meters along the quayside and stomped inside. Once again Alex had managed to make a fool of her!

A few minutes later she had changed into her old pair of skirt-pants and blue T-shirt and had stuffed the dress inside the bag. Walking back to Alex she had cooled down a little. Of course Alex would try and do something a little different, so she should have asked rather than get pissed at him. Would Deianeria get pissed at him? Probably not. She would wait until the right moment and then get him. Elizabeth decided that’s what she would do. "That any better?" She asked.

Alex gave a nod, "Perfect. Now we can get in the boat. We still have a trip to Rangali to make."

Alex helped Elizabeth into the motor launch before getting in himself. With a whir the motor launch’s electric engines started and they were underway.

Darkness had fallen suddenly and with the turquoise sea now an eerie black Elizabeth had not much to look at. The garish neon front of Male quayside had started to diminish. She turned to Alex who was still looking at the array of neon lights falling slowly away from them. Elizabeth sat crossed legged and just staring straight ahead. In spite of letting Alex off a little for the dress code mix up she was still annoyed to have been tricked into coming out with him in the first place. She was however honor bound to abide by the terms of the bet. "You can’t get into the Hilton dressed like this!" Elizabeth stated to Alex.

Alex shook his head. "You’ll see soon enough."

Elizabeth was getting a little tired of this mystery tour game Alex was playing but still couldn’t help but be intrigued. Part of her was enjoying it a great deal. Maybe she’d misjudged Alex. Not wanting to give Alex any more entertainment or spoil the boat trip she sat and looked out into the black ocean.

"Mysterious isn’t it? I mean anything could be down there and probably is, "Alex commented.

Elizabeth didn’t reply. She knew very well what was down there.

Fish. She did however cast a glance in Alex’s direction.

"Yunno Elizabeth, " Alex continued

Elizabeth didn’t reply. She was still wondering what Alex had planned for her.

"I’m not always out to show you up," Alex went on. If he was to get any enjoyment out of this evening he had to offer Elizabeth an olive branch.

‘Yeah, right’ Elizabeth thought but said nothing.

"Sometimes I am and that’s because I just don’t know how to take you. How about we start again? Forget I tricked you into coming and let’s just enjoy the evening. Before we know it the vacation will be over and we won’t see each other again for a few months,"

‘Suits me’ Elizabeth thought and nearly said it. But why was Alex telling her all this? Why did he want to make peace with her? Instead she shifted her gaze to the flickers of phosphorescent light from the plankton that flowed from either side of the boat.

Alex tried again. He was tempted to make some sarcastic comment but thought better of it "How do I handle you Elizabeth? Every time I see you I am in awe of you. I guess my teasing is my defense mechanism for me being tongue tied."

Elizabeth turned to look at Alex. Alex shy? Never! In awe of her? No way. She couldn’t resist answering this time "Alex I’m getting fed up of me answering you and then you’re twisting it around and making me look foolish."

Alex gave Elizabeth a serious look, "That’s what I’m trying to say. We’ve been at each other throats, in a playful fashion since we were little. I’m getting tired of pretending we’re both twelve but I don’t know how else to deal with you."

Did Alex really mean this or was it some ploy? Elizabeth decided to bite once more. If it meant the end of their constant sparring then anything was welcome. "Then treat me as anyone else not your kid sister."

Alex nodded, "I know it’s just that..."

"Just what?" Elizabeth demanded

"Tell you later, " Alex said softly.

"I knew you’d do this too me! You always try and drag things out for your own personal little games!" Elizabeth snapped.

"Elizabeth, It’s not like that at all. I promise. Look we’re nearly docked. It’s time for your surprise," Alex said softly.

Elizabeth noted the hurt look on Alex’s face but couldn’t be sure if it was genuine or not. Anyway, as Alex said the boat was about to dock.

Alex was the first off and took Elizabeth’s hand to help her off the boat. Strangely for Alex she did so without complaint. After being passed their bags Alex pointed to the Hilton hotel, which was a small walk away, "That’s where we’re going."

"If you say so, but they’ll not let us in, "Elizabeth stated.

"Now the old Alex would now place a bet and trip you up, but the new one is just going to say ‘trust me’," Alex said with a smile.

They walked in silence for a few minutes until they reached the elaborate entrance of the Hilton Hotel. It was split between the two islands of Rangali and Ranglifinolhu and much of it was now sited underwater. Only the tops of a few luxury lodges peeked above the reef surrounding the islands. Elizabeth went to walk inside the entrance but Alex pulled her to one side, "Not that way!"

"Alex where are we going?" Elizabeth demanded.

"Round the side entrance, come on," Alex gave Elizabeth a mischievous look and ran off.

Elizabeth raced after him, determined to see what harebrained scheme Alex had cooked up. She followed Alex down a dark side alley until the reached a door marked ‘staff entrance’. Alex indicated that they should go in there.

"Why are we here?" Elizabeth hissed.

"Shh," Alex said and rapped a sharp tattoo on the door.

A few seconds later and a small Hispanic man with short dark cropped hair and wearing a white overall opened the door. On seeing Alex he broke out into a wide smile, "Alex Hi. It’s great to see you again. It’s been a while."

"Obrigado, Manuel. Faz muito tempo desde a nossa

pescaria," Alex said in fluent Portuguese

Manuel gave an even wider smile, "Thank you we must try to meet up more often. This face I know. Elizabeth right?" he said turning his smile to Elizabeth.

Elizabeth was mystified. Who were these people and how did Alex know them? "Alex please introduce me."

"Oh I’m sorry. Manuel is one of the senior chefs here. I met him last year while I was fishing. Anyway we’re here to help him," Alex stated.

"Help him?" Elizabeth queried.

"Yep," Alex said with a smile.

"Not to eat?" Elizabeth was starving. What in hell was Alex playing at?

"Not yet. First of all we have to earn it,"

Elizabeth grabbed hold of Alex’s arm and pulled him outside, "What do you mean ‘earn it’?" she hissed.

"No I didn’t forget my wallet nor is mom broke. How many five star restaurants have you eaten at?"

"More than I can remember," Elizabeth admitted.

"How many restaurants have you worked at?" Alex asked with a smile.

Elizabeth said "None."

"If I’d have taken you out for a meal here then it wouldn’t be unique would it? You’d have it labeled as ‘just another meal at a top class hotel, boring!’ This way we get to eat and have fun beforehand doing something you’ve not done before."

"I guess," Elizabeth confessed. She must admit part of her was finding all this good food a little dull. How did Alex know? So that’s why he’d dressed in casual clothes. They were going to work!

Alex poked his head around the corner of the door and called "Manuel, para começar, o que você tem para nós fazermos?"

Manuel’s beaming face appeared around the door "What have I got for you to do? Well Alex, You take the dirty plates and after putting the remains in the trash you give them to Elizabeth for washing."

"We’re going to wash up?" Elizabeth stated.

Alex nodded, "Looks like it. Manuel will show us."

Elizabeth sighed ‘oh well in for a penny’

Manuel led them inside to a vast kitchen area. Every surface was immaculate and all around them the staff moved as though in some kind of military operation. Elizabeth was impressed by the efficiency of it. Manuel led them thru to a large container full of boiling water.

Manuel showed Elizabeth. "We don’t use dishwashers here as they ruin the plates and they are much slower than this method. Just put the plates in this rack here and drop them in. Careful, this water is literally boiling. Pull the covers over like this, " Manuel pulled a large plastic cover over the container and locked it in place with five clips.

"Got it," Elizabeth said. This was a really demanding job she thought sarcastically.

Manuel then pointed to a dial on the side of the container. "Turn this three clicks and count to thirty. Now this is the careful bit. Unclip the cover and gently pull the Racks out. Get Alex to help you or you’ll scald yourself. Since the water is superheated the plates will be dry almost as soon as they come out. There we go, that’s it."

"Ok what’s Alex’s job?" Elizabeth asked.

"I told you. He scrapes off all the remains of the food and gives the plates to you," Manuel said with a smile.

"Is that all?" Elizabeth asked. Once again Alex had got off lightly.

"Alex goes fishing with me, so I give him the easy job," Manuel grinned again at Elizabeth.

This was not turning out as Elizabeth expected at all. But she had resigned herself to doing it. "Come on Alex, I need those plates," she demanded. If Alex had the easy job, Elizabeth decided she was going to do her best to make sure he did it faster than he would like to.

"Already there," Alex smiled handing Elizabeth a stack of ten plates.

Elizabeth soon got the hang of it. Actually it took her two goes to perfect the technique and soon she and Alex were on autopilot. Half an hour went by as if it was only a minute.

"You know what?" Alex asked handing Elizabeth a particularly dirty plate.

"What?" Elizabeth had found the last half hour strangely relaxing. She had nothing to do per se and so her mind had relaxed. Thoughts of Deianeria had been lost in the routine of grab, stack, dunk and unpack.

"When asked to describe relativity Albert Einstein once said that if you were sitting on a hot stove two minutes seemed like two hours but when you were with a beautiful girl two hours seemed like two minutes. I just want you to know that this seems like two hours!" Alex’s eyes were gleaming with mischief.

Elizabeth couldn’t help but smile inside. She was still holding the drying up towel in her hand and gave Alex a playful flick with it. "You!"

"Better hurry up—we’ve only got half an hour left," Alex stated and handed Elizabeth some more plates and bowls.

"Til what?" Elizabeth said. Much to her amazement she was really enjoying herself. Once she’d got over the fact that it was Alex she was with she found herself enjoying his company.

"Til we eat of course. I promised you a meal didn’t I?"

"I’m starving. Hand me those plates and no more talking," Elizabeth ordered.

"Yes Ma’am, " Alex gave a salute.

Half an hour later Manuel came and inspected their work. He gave a broad smile and nodded his approval. "Alex sua presença é pedido na praia"

"Thank you Manuel." Alex said and fished inside his pocket and removed a blindfold.

"What’s that for?" Elizabeth demanded.

"You. Now put this on. I’ll lead you to where we need to go, "Alex said handing the blindfold to Elizabeth.

"You’re not going to make me walk into a swimming pool are you?" Elizabeth stated. Things got more and more mysterious.

"No. Here let me help," Alex said placing the blindfold over Elizabeth’s eyes. Elizabeth instinctively went to pull it off. She hated being out of control. She felt Alex’s strong hand take hers and she decided to let him play his little game with her.

Still holding Elizabeth by the hand Alex let her down the street and back onto the quayside. For her part Elizabeth was expecting to fall into a swimming pool, be left blindfolded in the middle of the street or some other such humiliating scenario. She had decided to give Alex a chance, so it was now down to him to prove or disprove the trust she’d placed in him.

Alex knew exactly where her was taking Elizabeth. "Wait here and don’t move." He instructed Elizabeth.

Not having any choice except by ruining the game, Elizabeth stayed still hardly wanting to breathe. To her surprise she found the constant suspense and surprise exhilarating. She’d hadn’t had that many surprises for a long while, and the feeling of being out of control of one’s destiny and future was an intoxicating one. Deianeria would disapprove of course but she had been put aside for a few days. She felt Alex’s hands lift her up around her waist as though she was made of paper. She hadn’t realized how strong he was before. She felt a slight swaying motion as Alex put her down. So Alex had put her on a boat!

"Why are we on a boat?" She asked.

"Because that is where we need to be," Alex answered cryptically.

"Ok you win," Elizabeth admitted. She was by now totally mystified and enthralled by Alex’s little games.

Elizabeth had no idea how long they were on the boat but she guessed it would have been about twenty minutes. Alex had insisted on her keeping her blindfold on, and by now Elizabeth didn’t really mind. She was now sure that Alex wasn’t going to trick her. She felt a slight bump as the boat docked somewhere. It couldn’t be that far away from where she’d started off. It would be just like Alex to make her go in circles for a while and then they’d arrive back where they started. She hadn’t detected any changes of course, however. So where were they?

"Elizabeth, hold still," Alex said and Elizabeth felt herself being lifted up once more by Alex. She was now completely at his mercy and somehow it had a releasing effect on her. She felt herself being placed onto a quay and told to stay there.

A few seconds later she felt Alex grab her hand once more and gingerly she started to be led by him. All she could hear was the wash of the water against dockside wooden beams and then the wash of water on the ocean shore. So she wasn’t on a resort island then? She would have heard music by now if she were. Now what non resort island was within twenty minutes of Rangali? In her mind’s eye a map of all 1,195 islands that make up the Maldives appeared. She traced all possible routes from Ranagli and drew a circle representing a twenty minute journey time around it. Only one place stood out, Hukurudhoo island.

"Alex, I know where we are!" She whispered.

"I thought you might. That photographic memory must be useful sometimes," Alex smiled. He was within twenty feet of where he needed to be.

"We’re on Hukurudhoo," Elizabeth stated triumphantly.

"Wait," Alex commanded. Elizabeth did so.

Elizabeth felt Alex reach around the back of her head and remove the blindfold. It took a few moments for her eyes to adjust to the difference in light, and after the blurs had focussed she looked around.

In front of her was a dining table. By the looks of it, it had come from a five star restaurant as it was ornately laid out with what looked like a silk table cloth. Standing on two tall stands was two flaming torches. The firelight cast flickering red, yellow and white light all around the area and it spread all the way to the ocean just a few feet away. Sitting beside the table were several large plastic boxes and to one side in a bucket was a bottle of champagne. On the table were two wine glasses, and on one of the chairs a large bouquet of exquisite orchids.

"Alex, what is this?" Elizabeth asked.

"Dinner. You like it?" Alex said with a smile. He knew she did!

"It’s, it’s...," Elizabeth started. She’d never dreamed that Alex could come up with something this inventive, this surprising. She had misjudged him for a long time. There was now, clearly, much she didn’t know about him.

"Come on, I don’t know about you, but I’m starving. Here let me," Alex said and showed Elizabeth to her seat.

Elizabeth picked up the orchids and gave them a sniff. Their fragrance assaulted her senses. The smell was like nothing she had imagined. It had flavors of the orient, the amazon and lofty alpine peaks. It was, she decided, a world map of scent and the most incredible array of flowers and colors she had ever seen. "Alex, this is incredible. It must have cost.."

Alex sat down on the opposite end of the table and looked Elizabeth in the eye. "Doesn’t matter. This is OUR evening. Now the small blue plastic box contains our starters. I took the liberty of ordering for you. It’s hard to get the staff this far out."

Elizabeth smiled, "So we are on Hukurudhoo?" She passed Alex the blue box.

"Yep. I never could keep anything from you for very long, could I?" Alex said as he reached down and retrieved two plates from a red box by his feet. He gingerly put them down on the table. "Good they’re still hot."

Elizabeth noted the Hilton hotel’s logo on the sides of the china plates. So Alex had got the stuff from the Hilton. "It all fits," she stated.

"What does," Alex said, spooning some kind of seafood platter onto Elizabeth’s plate.

"The reason why we had to work for our dinner. Manuel needed two people to cover for him while he sent two of his guys out to do all this." Elizabeth gestured to her exotic surroundings.

"Right again. He’d be in real trouble if he suddenly went two people down on a shift. Therefore we had to fill in while they went off and did all this. Besides, it adds a little more spice to evening."

"Thank you Alex. I don’t know what to say. It’s wonderful," Elizabeth admitted.

Alex finished serving up the starters and poured two glasses of champagne He gave one to Elizabeth and kept hold of the other, "Thank you. It’s taken me ages to plan out. Here’s to us." With a clink they tapped glasses.

"Elizabeth?" Alex asked.

"Yes. This seafood is fantastic," Elizabeth commented.

"You’ve not been yourself since you arrived back home from Cambridge.

You’ve been on edge all the time you’ve been here. What’s up?"

Alex said, the concern showing in his eyes.

"It’s just a project I have going on that’s all." Elizabeth didn’t particularly want to ruin the mood by talking about that.

"It’s more than a project to you, isn’t it? You seem to forget I know you more than you do yourself. We grew up together. I know when something’s up. I think I know what it is," Alex said, putting his knife and fork down.

"What is it?" Elizabeth said a little defensively.

"Judging by you going around wearing Elizabeth Bexley’s old wardrobe, I think you’re doing an in depth study into the Fury. Trust me it’s a pointless exercise."

Elizabeth’s face had turned to stone. There was no point in denying it. How did he know? "It’s not a pointless exercise. Don’t you want to know the truth?"

Alex shook his head, "Why bother? What’s done is done. It all went on over twenty years ago. We can’t change what occurred all that time ago but we can—and we all need to—move on from it. Mom, Matthew, and Kat, and you too."

"Even if what we’ve been told is a lie?" Elizabeth stated.

Alex studied Elizabeth’s face. Her blue-gray eyes were afire. This was important to her! "It’s not a lie, Elizabeth. Sure, the government has classified everything to do with it, and that’s helped fuel the lie that my mom and yours made this all up, but what about all those people who were affected by Bexley? You can’t create a conspiracy with that many people in it. Sooner or later someone blabs and it’s all out in the open. All this investigation is doing is screwing with your mind."

Elizabeth was now feeling a little angry. Deianeria wasn’t screwing with her mind. Deianeria was an essential part of her getting to know herself. Alex couldn’t know the desperation she felt, and had felt for some time, about her fears for the future. She was right about not telling Alex about Deianeria after all. "Thanks for your concern Alex. But it’s not you who looks like HER is it? It’s not you who’s had those cult bastards after you. I need to know all about this. It’s not for them, it’s for me. I need to know who I am."

Alex nodded, "I know. You remember when I tried to find my father’s body a while back? Mom told me he had been killed during the guild war after screwing her when she was in Osman’s harem. She never even knew him, didn’t even know she was pregnant until much later on, and she raised me as best as she could. I know she’s been lonely ever since John was killed, and in spite of the rumors I know she’s not had any one else. She doesn’t want anyone else! I know what it’s like not to know who you really are. At least you know where you came from. I gave up on trying to find him, I spoke to everyone who was there at the time, Mom, Tina, Scott and everybody, but they had no idea and could offer no leads. So I dropped it, figuring that what mattered was that my family loved me and that who I am is only up to one person, me."

Elizabeth felt a little guilty about being angry at Alex, "I remember your search. You ended up looking more sad and depressed than I can ever remember."

Alex nodded, "It took me months to get over that disappointment. Listen, all that awaits you if you persist with this project of yours is pain and fire. I’ll leave it at that. You make your own mind up. You always did and always will. It’s one of the things I like about you."

Elizabeth had to concede Alex made a valid point, but her pride was at stake. She had to prove the Bexley cult wrong for herself and for the world. All that she held dear was in danger until she did. She decided to let it drop. It would ruin the evening if she carried on as she did. "You’d better hurry up. I’ve finished my starters,"

"Ok, will do," Alex said and started to eat once more.

Alex had only half eaten his starters so Elizabeth took a further look around. It wasn’t cold outside and a gentle sea breeze just kept things from being too humid. The gentle lapping sound of the water relaxed her and she found the setting more idyllic than even her parents island. After all that was just home, this was close to heaven! Elizabeth studied Alex’s face. She hadn’t really noticed it but he had inherited Cathline’s look of integrity and nobility. Of course his jet black hair and dark complexion came from his unknown father and his deep brown eyes gleamed with sharp intelligence, wit, and compassion.

"Time for the main course, pass me the large yellow box please, "Alex asked.

Elizabeth did so, boy was it heavy, "What are we eating Elephant?"

"Nope just Manuel’s special duck,"

Elizabeth cast her mind back to the conversation on the boat going over from Male. "You said you were in awe of me? Why"

Alex waited until he’d placed a perfectly cooked duck breast on Elizabeth’s plate, "Because I am. You are the most remarkable woman I have ever met. You are just simply devastating, in intelligence, beauty, and heart. That’s why I get so tongue tied around you and resort to teasing. I have no idea how to handle you."

"You trying to seduce me?" Elizabeth asked with an incredulous look on her face. Alex and herself, what a joke!

Alex gave one of his beaming smiles, "What I was trying to say to you on the boat was that in spite of everything we’ve done to each other, the jokes, teasing and fighting, in spite of the big brother act, I can’t help but admit to you I’m falling in love with you. I didn’t plan it this way. It just happened."

Elizabeth dropped her fork in shock. Alex in love with her? How come? "Alex this is the most cruel joke you’ve played on me. How dare you!" she snapped and rose from the table.

Alex stood up and grabbed hold of her arm, "It’s no joke Elizabeth. I realized while you were away that I missed you. That I wasn’t able to be the person I wanted to be while you weren’t around. Elizabeth. I love you. There I said it!"

"I don’t know what to say," Elizabeth said. How had it come to this?

"Neither do I. Not any more. It’s taken me years to work out what it was that made me so awkward around you. Please tell me how you feel," Alex said.

"Feel? I feel confused. How can you fall in love with me Alex? I thought you hated my guts. We’re opposites in everything we say and everything we do." Elizabeth walked away from the table. She needed to think for a while.

Alex walked after her and soon caught up. "Elizabeth do I have any chance with you? Please I need to know."

"Alex I just don’t know. I came on this date thinking you were setting me up and now you tell me you’re falling for me." Elizabeth turned to face Alex. She looked up into his eyes. They were full of expectation, fear and concern. He was telling the truth.

"I’m sorry. I needed to get you on your own so I could tell you. I just had to, otherwise I’d live my life out in ‘what ifs’ and maybes. You want to find out who you are, let’s both find out who we are together." Alex’s voice was now a whisper.

To her surprise Elizabeth didn’t move away. She didn’t know the reason, just that to move away would be wrong. It was as if some external force had paralyzed her legs. Her heart was telling her to stay, and in matters of the head and heart the heart always wins.

Alex took hold of her and drew her close. To his surprise he felt no resistance and he moved in and kissed Elizabeth on her lips. Elizabeth pulled away. "How dare you!" she snapped, and slapped him full around the face.

Alex turned to leave, his heart in tatters.

"No you don’t! come here!" Elizabeth roared and pulled Alex back towards her. Then much to Alex’s astonishment Elizabeth kissed him back.

Elizabeth felt as though a fire within her had been lit. Her mind told her that kissing Alex was an insane thing to do. That no way this would work out and the only reward would be pain, and loss of a good friend. Her heart told her that something within them had just connected. It was as if two souls had just joined for the first time after centuries of searching. She felt Alex pull her closer to him and his strong arm enveloped her waist. Every kiss they shared made her feel more alive than she ever had been before.

Instinctively she unbuttoned his shirt and ran her hand over Alex’s strong, muscular chest. Alex was kissing her neck and gently kissing her ears. Tingles ran down her spine—this was so right! How had she been so blind?

She managed to pull away for a second, "Alex we need to talk?"

Alex stopped kissing Elizabeth’s neck and nodded his agreement, "I’m sorry. This just felt so right."

Elizabeth put her finger to his lips, "Don’t be sorry, it IS right. I never realized it before but I feel as though we just connected. Like this was supposed to happen."

Alex took hold of Elizabeth’s hand and drew his arm around her.

"I know. Scary isn’t it? Where do we go from here?"

Elizabeth put her arm around Alex’s waist. She felt safe and secure there. It was an unfamiliar but welcome feeling. "One step at a time. Starting with dinner."

Alex turned and gave her a peck on the cheek, "Always the practical one."

A few minutes later they had both sat down and were playing footsie under the table. Alex felt a tingle every time Elizabeth ran her foot around his. He couldn’t believe that this incredible woman wanted to be with him. His heart was soaring and he had never been so happy or content. It was as if his entire life had led up to that kiss on the beach. Whatever tomorrow brought he would always have that kiss.

The young couple on the beach spent the rest of the main course looking into each other’s eyes, holding hands at the table and making small talk. Whatever or whoever had brought their souls, their lives and their love together was establishing a foothold and wasn’t about to let go.

"Let’s take a walk. Desert can wait, " Elizabeth said.

Alex nodded "Cherish the love, cherish the life."

"Sorry?" Elizabeth queried

"Old song. Sorry, " Alex admitted. What had made him say such a stupid jerky thing?

Elizabeth wasn’t into songs but Deianeria was. "How’d it go?"

Alex shrugged "I don’t really remember. Sorry. I was just thinking that no matter what happens tomorrow or the next day I’ll always cherish this night."

Elizabeth drew Alex along side her and rested her head on his broad shoulders, "Me too," she whispered.

"Look I can see a ship in the distance. Wonder where’s it going?" Alex pointed to a row of lights near the horizon.

"Who knows?" Elizabeth shrugged.

"Just think. Out there," Alex pointed to the horizon, "There are people meeting their someone for the first time. Millions and millions of somebody’s looking for their own someone."

"I guess so. I hadn’t thought of it in that way," Elizabeth admitted.

Alex gave a laugh and drew Elizabeth in for another kiss. She responded then she broke away. "One step at a time."

Alex smiled, "Agreed. Where do we go from here, after desert that is? I think we just see how it goes. Let’s enjoy now and worry about the kids later?"

"Kids? You expect me to have your kids? I’ve only starting to get used to idea of you as boyfriend material," Elizabeth smiled

Alex checked his watch "Later. Look it’s getting late. We’ll take desert back with us."

"Ok. Alex?"

"Yes?"

Elizabeth looked Alex in the eyes "Tonight has been wonderful. I never dreamed it would work out like this or I would feel the way I feel. I guess, deep down somewhere I liked you too. It needed your courage to make me realize that. Maybe I was afraid to look beyond my teasing and ‘oneupmanship’ to see what was beneath."

"What is beneath?" Alex asked

Elizabeth pulled Alex in for another kiss. "Hope."

o—o—o—

 

(Continued in 8b)

© 2000
The above work is copyrighted material. Anyone wishing to copy, archive, or re-post this story must contact the author for permission.